ID: 1001764614

View in Genome Browser
Species Human (GRCh38)
Location 5:174235579-174235601
Sequence TTTAAGTTCTTGAAGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1612
Summary {0: 1, 1: 0, 2: 2, 3: 93, 4: 1516}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001764614_1001764622 18 Left 1001764614 5:174235579-174235601 CCCCATCACTTCAAGAACTTAAA 0: 1
1: 0
2: 2
3: 93
4: 1516
Right 1001764622 5:174235620-174235642 TCAGAAACCAATAACCTGTTTGG 0: 1
1: 0
2: 1
3: 11
4: 149
1001764614_1001764619 -10 Left 1001764614 5:174235579-174235601 CCCCATCACTTCAAGAACTTAAA 0: 1
1: 0
2: 2
3: 93
4: 1516
Right 1001764619 5:174235592-174235614 AGAACTTAAAAGATTTTGGAGGG 0: 1
1: 0
2: 1
3: 49
4: 549
1001764614_1001764620 -5 Left 1001764614 5:174235579-174235601 CCCCATCACTTCAAGAACTTAAA 0: 1
1: 0
2: 2
3: 93
4: 1516
Right 1001764620 5:174235597-174235619 TTAAAAGATTTTGGAGGGCCAGG 0: 1
1: 0
2: 6
3: 65
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001764614 Original CRISPR TTTAAGTTCTTGAAGTGATG GGG (reversed) Intronic
900638680 1:3677875-3677897 TTTAAGTTTTTGGAGAGCTGAGG + Intronic
900667807 1:3827390-3827412 TTTAAGTTTTAGTAGAGATGAGG + Intronic
900769987 1:4533180-4533202 TTTATGTTTTTGTAGAGATGGGG - Intergenic
901028051 1:6289544-6289566 TTTAAATTTTTGTAGAGATGGGG + Intronic
901029183 1:6296742-6296764 TTTATTTTCTTGCAGAGATGGGG + Intronic
901281785 1:8043035-8043057 TTTAGTTTATTGAAGTGATCTGG - Intergenic
901507759 1:9696577-9696599 TTTTATTTCTTGTAGAGATGGGG - Intronic
901824822 1:11854338-11854360 TTTAATTTTTTGTAGAGATGGGG - Intergenic
901825060 1:11855919-11855941 TTTCATTTCTTGAAGATATGGGG + Intergenic
902059903 1:13633453-13633475 TTTAATTTTTTGTAGAGATGGGG - Intergenic
902077171 1:13796581-13796603 TTTTATTTCTTGTAGAGATGGGG - Intronic
902253869 1:15174693-15174715 TTTATTTTCTTGAAGTTCTGGGG + Intronic
902328295 1:15717077-15717099 TTTAAATTTTTGTAGAGATGGGG - Intronic
902389996 1:16097941-16097963 TTTAATTTTTTGCAGAGATGGGG - Intergenic
902395584 1:16130800-16130822 TTTAATTTTTTGTAGAGATGGGG + Intronic
902418550 1:16258527-16258549 TTAAATTTTTTGTAGTGATGGGG + Intronic
902874478 1:19332595-19332617 TTTAAATTTTTGTAGAGATGGGG - Intergenic
903121681 1:21220320-21220342 TTTAATTTTTTGTAGAGATGGGG - Intronic
903212484 1:21826240-21826262 TTAAATTTCTTGTAGAGATGAGG + Intronic
903548109 1:24139708-24139730 TTAAATTTTTTGTAGTGATGGGG + Intronic
904000907 1:27338032-27338054 TTTAATTTTTTGTAGAGATGGGG - Intergenic
904094104 1:27964469-27964491 TTTAAAATTTTGAAGAGATGAGG - Intronic
904131094 1:28275880-28275902 TTTAATTTTTTGTAGAGATGGGG - Intronic
904137064 1:28321366-28321388 TTTAATTTTTTGTAGAGATGGGG + Intergenic
904152320 1:28452331-28452353 TTTAATTTTTTGTAGAGATGGGG - Intronic
904202457 1:28829880-28829902 TTTAATTTTTTGTAGAGATGGGG + Intronic
904229840 1:29059601-29059623 TTTTATTTTTTGAAGAGATGGGG - Intronic
904630729 1:31840254-31840276 TTTAATTTTTTGTAGAGATGGGG + Intergenic
904729190 1:32575674-32575696 TTTAATTTTTTGCAGAGATGGGG - Intronic
904749615 1:32733369-32733391 TTTAAATTTTTGTAGAGATGGGG + Intergenic
904778982 1:32930578-32930600 TTTAACTTTTTGTAGAGATGGGG + Intergenic
904790539 1:33017011-33017033 TTTAATTTTTTGTAGAGATGAGG + Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
905076342 1:35274430-35274452 TTTAATTTATTGTAGAGATGGGG - Intronic
905085848 1:35375901-35375923 TTTAACTTTTTGTAGAGATGAGG - Intronic
905158806 1:36013109-36013131 TTTAATTTTTTGTAGAGATGAGG + Intronic
905413804 1:37791236-37791258 TTTAATTTTTTGTAGAGATGAGG + Intergenic
905590253 1:39157140-39157162 TTTTAGTTTTTGTAGAGATGAGG + Intronic
905813323 1:40929081-40929103 TTTAATTTTTTGTAGAGATGGGG - Intergenic
906339161 1:44963048-44963070 TCTAATTTTTTGAAGAGATGGGG - Intronic
906454187 1:45979650-45979672 TTTAATTTTTGGAAGAGATGGGG - Intronic
906503058 1:46356241-46356263 TTTAACTTTTTGTAGAGATGAGG + Intronic
906574046 1:46871638-46871660 TTTAAATTTTTGTAGAGATGGGG + Intergenic
906721409 1:48007853-48007875 TTTTATTTTTTGAAGAGATGGGG - Intergenic
907122065 1:52016760-52016782 TTTAATTTTTTGTAGAGATGGGG - Intergenic
907473484 1:54689835-54689857 TTTATTTTTTTGGAGTGATGGGG - Intronic
907640380 1:56183239-56183261 TTTAATTTTTTGTAGAGATGGGG - Intergenic
907649773 1:56284073-56284095 TTTAATTTTTTGTAGAGATGGGG - Intergenic
907757724 1:57327110-57327132 TTTTATTTTTTGTAGTGATGGGG + Intronic
908013474 1:59807621-59807643 TTTCATTTCTTGTAGCGATGCGG - Intergenic
908187103 1:61662906-61662928 TTTAATTTTTAGTAGTGATGAGG + Intergenic
908369430 1:63467053-63467075 TTTTAGTTTTTGTAGAGATGGGG + Intronic
908441290 1:64157309-64157331 TTTAATTTTTTGTAGAGATGGGG + Intronic
908450279 1:64247689-64247711 TTTAATTTTTTGTAGAGATGAGG - Intronic
908540453 1:65117182-65117204 TTTAATTTTTTGTAGGGATGAGG - Intergenic
908804661 1:67917881-67917903 TTTTATTTTTTGTAGTGATGGGG - Intergenic
909198362 1:72656176-72656198 TTTAATTTTTTGTAGAGATGAGG - Intergenic
909400765 1:75227190-75227212 TTTAATTTTTTGTAGAGATGGGG - Intronic
909442241 1:75710381-75710403 TTAAAGTTTTTGTAGAGATGGGG - Intergenic
910042321 1:82867698-82867720 TTTAATTTTTTGTAGAGATGGGG + Intergenic
910170828 1:84375044-84375066 TATAAGTTGTTGAAGTCATTGGG - Intronic
910213557 1:84818630-84818652 TTTAAGTTCTTTAAGTTGGGTGG - Intronic
910234654 1:85023251-85023273 TTTAATTTTTTGTAGAGATGGGG + Intronic
910970815 1:92854057-92854079 TTTAATTTTTTGTAGAGATGGGG + Intronic
910995181 1:93096980-93097002 TTTAATTTTTTGTAGAGATGCGG + Intronic
911007965 1:93247586-93247608 TTTAATTTTTTGTAGAGATGGGG + Intronic
911175564 1:94814163-94814185 TTTAAGTTTTTGAAATGAGTTGG + Intergenic
911376541 1:97057879-97057901 TTTAGCTTCTGGAGGTGATGAGG - Intergenic
912284643 1:108356186-108356208 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
912521365 1:110247380-110247402 TTTAATTTTTTGTAGAGATGGGG + Intronic
912801321 1:112721484-112721506 TTTAATTTTTTGTAGAGATGGGG + Intronic
912991227 1:114488589-114488611 TTTAATTTTTTGTAGAGATGGGG - Intronic
913407092 1:118506411-118506433 TTTAAATTTTTGTAGTGATGAGG - Intergenic
913554480 1:119951322-119951344 TTAAATTTCTTGTAGAGATGAGG + Intronic
914266367 1:146041594-146041616 TTTAACTTTTTGTAGAGATGAGG + Intergenic
914324368 1:146597080-146597102 TTTAATTTTTTGTAGAGATGGGG - Intergenic
914488861 1:148136889-148136911 TTTAAGCTTTTGATCTGATGTGG + Intronic
914758715 1:150581600-150581622 TTTTATTTCTTGTAGAGATGGGG + Intergenic
914839619 1:151237486-151237508 TTTGAGTTTTTGTAGTGATGAGG - Intronic
914895817 1:151671408-151671430 TTTAAGTTTTTGTAGAGGTGGGG + Intronic
915075044 1:153301091-153301113 TTTATTTTTTTGAAGAGATGGGG + Intronic
915247444 1:154566850-154566872 TTTAAGTCCCTGAAGTGTGGGGG + Intergenic
915339966 1:155171683-155171705 TTTAAGTTTTTGTAGAGATGGGG - Intronic
915434420 1:155892826-155892848 TTTAAATTTTTGTAGAGATGGGG + Intergenic
915580530 1:156810208-156810230 TTTCATTTCTTGTAGAGATGAGG + Intronic
915849728 1:159308753-159308775 TTTAATTTTTTGTAGAGATGAGG + Intergenic
916062133 1:161106810-161106832 TTAAACTTTTTGTAGTGATGGGG + Intronic
916183394 1:162107514-162107536 TTTAATTTTTTGTAGAGATGGGG + Intronic
916686665 1:167153427-167153449 TTTAATTTTTTGTAGAGATGGGG + Intergenic
916729935 1:167556910-167556932 TTTAATTTTTTGTAGAGATGGGG + Intergenic
916861030 1:168805778-168805800 TTTAATTTTTTGTAGAGATGGGG + Intergenic
916971139 1:170017674-170017696 TTTAAGTCCAGGAGGTGATGTGG + Intronic
917012380 1:170488808-170488830 TTTAATTTTTTGTAGAGATGGGG - Intergenic
917297262 1:173533449-173533471 ATTAATTTTTTGTAGTGATGGGG + Intronic
917402938 1:174671504-174671526 TTTTAAATCATGAAGTGATGTGG + Intronic
917409987 1:174749504-174749526 TTTACTTTCTTGTAGAGATGGGG + Intronic
917507855 1:175644770-175644792 TTTCTGGTCTTGAAGTGCTGTGG + Intronic
917569541 1:176250909-176250931 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
917863554 1:179171694-179171716 TTTATGTTTTTGTAGAGATGGGG + Intronic
917965024 1:180173132-180173154 TTTAACTTTTTGTAGAGATGGGG + Intronic
918001252 1:180499421-180499443 GTCAAGTTCTTGAAAGGATGAGG + Intronic
918297684 1:183172311-183172333 TTTAATTTTTTGTAGAGATGGGG - Intergenic
918325947 1:183410888-183410910 TTTAAATTTTTGTAGAGATGGGG + Intronic
918961010 1:191277746-191277768 TTTAATTTTTTGTAATGATGGGG + Intergenic
919081430 1:192871261-192871283 TTAAATTTCTTGTAGAGATGGGG - Intergenic
919102512 1:193111888-193111910 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
919489763 1:198192412-198192434 TTTAATTTATTGGTGTGATGTGG + Intronic
919637601 1:200017974-200017996 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
919706834 1:200684603-200684625 TTTAGTTTCTTGTAGAGATGAGG - Intergenic
919909651 1:202102978-202103000 TTTAAGTTTTTGTAGAGACGGGG - Intergenic
919954473 1:202399391-202399413 TTTAATTTTTTGTAGAGATGAGG + Intronic
920035624 1:203063610-203063632 TTTAAGATCTCGAAATGATACGG - Intronic
920164187 1:204024031-204024053 TTTTAGTTTTTGTAGAGATGGGG - Intergenic
920168040 1:204050010-204050032 TTTAAGTTTTTGTAGAGATGGGG + Intergenic
920234109 1:204491518-204491540 TTTAAGTTTTTGTAGAGATGGGG - Intronic
920530238 1:206696528-206696550 TTTAATTTTTTGTAGAGATGGGG - Intronic
921039272 1:211414832-211414854 TTTAATTTTTTGTAGAGATGGGG - Intergenic
921073322 1:211680131-211680153 TTTAACTTTTTGTAGGGATGAGG + Intergenic
921352874 1:214255659-214255681 TTTAATTTTTTGTAGAGATGGGG + Intergenic
921766429 1:218977897-218977919 TTTAATTTCTCAAAATGATGAGG + Intergenic
922135969 1:222826559-222826581 TTTAACTTCTTACAGAGATGGGG + Intergenic
922530188 1:226339304-226339326 TTTAATTTTTTGTAGAGATGGGG + Intergenic
922637693 1:227191945-227191967 TTTAAATTTTTGTAGAGATGGGG - Intronic
922747051 1:228050206-228050228 TTTTAGTTTTTGTAGAGATGGGG + Intronic
922932666 1:229402605-229402627 TTTAATTTTTTGTAGAGATGGGG + Intergenic
922961904 1:229654662-229654684 TTTAAATTTTTGTAGAGATGGGG + Intronic
923136445 1:231124314-231124336 TTAAATTTCTTGTAGAGATGAGG - Intergenic
923137333 1:231130043-231130065 TTTAATTTTTTGTAGAGATGGGG + Intergenic
923543923 1:234910150-234910172 TTTAATTTTTTGTAGAGATGGGG + Intergenic
923605462 1:235439136-235439158 TTTATGTTCTTGAAATGGAGAGG + Intronic
923616572 1:235543317-235543339 TTAAATTTCTTGTAGAGATGGGG + Intergenic
923730119 1:236542307-236542329 TTTAATTTTTTGTAGAGATGGGG - Intronic
923785298 1:237061482-237061504 TTTAATTTTTTGTAGAGATGAGG + Intronic
923982120 1:239336923-239336945 TTTAATTTTTTGTAGTGATGGGG - Intergenic
924141337 1:241027017-241027039 TTTAATTTCTGGTAGAGATGGGG - Intronic
924256781 1:242190707-242190729 TTTAATTTTTTTAAGAGATGAGG - Intronic
924653761 1:245953993-245954015 TTTAATTTTTTGAAGTAAAGAGG - Intronic
924809611 1:247389591-247389613 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1063227400 10:4028332-4028354 TGTAATTTCTTCCAGTGATGAGG - Intergenic
1063248237 10:4246302-4246324 TTTAAATTTTTGTAGAGATGAGG - Intergenic
1063448066 10:6132615-6132637 GTTAAGTTTTTGTAGAGATGGGG - Intergenic
1063454324 10:6172647-6172669 TTTAATTTTTTGTAGAGATGGGG - Intronic
1063642337 10:7842330-7842352 TTTAATTTTTTGTAGAGATGAGG + Intronic
1063674905 10:8132221-8132243 TTTAATTTCTAGTAGAGATGAGG + Intergenic
1064369703 10:14740652-14740674 TTTAACATCTTGCATTGATGTGG - Intronic
1064420822 10:15189347-15189369 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
1064439766 10:15343187-15343209 TTTATTTTTTTTAAGTGATGGGG - Intronic
1064534212 10:16342132-16342154 TTTAATTTTCTGTAGTGATGGGG - Intergenic
1064583042 10:16813134-16813156 TTTAATTTTTTGTAGAGATGGGG + Intronic
1064623389 10:17238242-17238264 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1064735191 10:18375043-18375065 TTTAAATTTTTGTAGAGATGGGG - Intronic
1064747406 10:18491409-18491431 TTTTACTTTTTGAAGAGATGAGG - Intronic
1064852395 10:19723566-19723588 TTTAATTTTTTGTAGAGATGGGG - Intronic
1064863420 10:19852229-19852251 TTTAATTTGTTGTAGAGATGGGG - Intronic
1064953112 10:20876706-20876728 TTTAAGTTTTGTAAGTAATGTGG - Intronic
1065002173 10:21347099-21347121 TTTAAGTTTTTGTAGAGATGGGG + Intergenic
1065044300 10:21732260-21732282 TTGAAGTACTTGAGGTGATGGGG + Intronic
1065368306 10:24955771-24955793 TTTAATTTTTTATAGTGATGTGG - Intergenic
1065439685 10:25738716-25738738 TTTTATTTTTTGTAGTGATGAGG + Intergenic
1065566469 10:27016160-27016182 TTTAAATTTTTGTAGAGATGGGG + Intronic
1065618615 10:27555215-27555237 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1065755713 10:28928571-28928593 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1065841374 10:29703971-29703993 TTTAATTTTTTGTAGAGATGGGG + Intronic
1065878766 10:30021369-30021391 TTTCAGTTTTTGTAGAGATGGGG + Intronic
1065928641 10:30458900-30458922 TTTAATTTTTTGTAGCGATGGGG - Intronic
1066051235 10:31637657-31637679 TTTAAATACTTGAAGTTCTGGGG + Intergenic
1066244691 10:33571181-33571203 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1066397650 10:35041707-35041729 TTTAATTTTTTGTAGAGATGGGG + Intronic
1067524720 10:47031374-47031396 TTTGAGTTCTTGAAATGTAGGGG + Intergenic
1068035594 10:51756312-51756334 TTTAATTTTTTGTAGAGATGGGG - Intronic
1068137743 10:52966888-52966910 TCTAAGATTTTGAAGAGATGTGG + Intergenic
1068334344 10:55612854-55612876 TTGAAGTTTATGAAATGATGTGG - Intronic
1068381678 10:56262010-56262032 TTTAACTTTTTGTAGAGATGAGG - Intergenic
1068524582 10:58113599-58113621 TTTAACTTCTTAAAGGGATGAGG - Intergenic
1068737693 10:60432771-60432793 TCTAAGATCTTGCAGTAATGAGG + Intronic
1068737750 10:60433324-60433346 TCTAAGATCTTGCAGTAATGAGG - Intronic
1068991210 10:63152822-63152844 TTTAAGTTTTTGTAGAGATGGGG - Intronic
1069009836 10:63360137-63360159 TTTAATTTTTTTAAGAGATGGGG - Intronic
1069033325 10:63620967-63620989 TTTAAATTGTGGCAGTGATGGGG + Exonic
1069441606 10:68433700-68433722 TTTAATTTTTTGGAGAGATGGGG + Intronic
1069441695 10:68434477-68434499 TTTAATTTTTTGTAGAGATGGGG - Intronic
1069480422 10:68776719-68776741 TTTAATTTTTTGTAGAGATGGGG + Intronic
1069483648 10:68806618-68806640 TTTAAATTATTGTAGAGATGGGG - Intergenic
1069506380 10:69001995-69002017 TTTAATTTTTTGTAGTGATGAGG - Intronic
1069527123 10:69182165-69182187 TTTAATTTTTTGTAGAGATGGGG + Intronic
1069654908 10:70080561-70080583 TTTAATTTCTTGTAGAGACGAGG - Intronic
1069661279 10:70125298-70125320 TTTAATTACTTGTAGAGATGGGG + Intronic
1069952672 10:72030513-72030535 CTCAAGGTCTTGAAGTTATGAGG + Intergenic
1070087217 10:73249089-73249111 TTTAAGTTTTTGTAGAGACGGGG + Exonic
1070294959 10:75152692-75152714 TTTAATTTTTTGGAGAGATGGGG - Intronic
1070331791 10:75422766-75422788 TTTAATTTTTTGGAGAGATGAGG - Intergenic
1071691804 10:87828134-87828156 TTTAATTTTTTGCAGAGATGGGG + Intronic
1071692146 10:87832216-87832238 TTTAATTTTTTGTAGAGATGGGG - Intronic
1071867122 10:89746735-89746757 TTTTAGTACTGGAAGTGATATGG - Intronic
1072012268 10:91312938-91312960 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1072041657 10:91612223-91612245 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1072080769 10:92028661-92028683 ATTGAGTACTTCAAGTGATGGGG - Intronic
1072181004 10:92979754-92979776 TTTAATTTTTTGTAGAGATGAGG - Intronic
1072233409 10:93432213-93432235 TTTAACTTTTTGTAGAGATGGGG - Intronic
1072350316 10:94550715-94550737 TTTAATTTTTTGTAGAGATGGGG - Intronic
1072354349 10:94592115-94592137 TTTAAGTTTTTTAAGTGACTTGG + Intronic
1072434279 10:95401206-95401228 TTTAATTTTTTGTAGCGATGGGG - Intronic
1072452368 10:95548626-95548648 TTCAAGTTTTTGTAGAGATGGGG + Intronic
1072645756 10:97252169-97252191 TTTAATTTTTTGTAGAGATGAGG - Intronic
1072919411 10:99563368-99563390 TTTAATTTTTTGTAATGATGGGG - Intergenic
1072993640 10:100223464-100223486 TTTAATTTTTTGTAGAGATGAGG - Intronic
1073010581 10:100356203-100356225 TTTAATTTTTTGTAGAGATGAGG - Intronic
1073213363 10:101822457-101822479 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1073407367 10:103309755-103309777 TTTAATTTTTTGTAGAGATGGGG - Intronic
1073733095 10:106314398-106314420 TTTGAGTTCTTGAAGCTATTTGG - Intergenic
1074384908 10:113009106-113009128 TTAAATTTTTTGAAGAGATGGGG + Intronic
1074396379 10:113101368-113101390 TTTAATTTTTTGTAGAGATGGGG - Intronic
1074478401 10:113794762-113794784 TTTAAATTCTTGAACTGCTTGGG - Intergenic
1074640633 10:115376459-115376481 TTTTAGTTTTTGAAGATATGGGG + Intronic
1074640641 10:115376529-115376551 TTTTAGTTTTTGAAGATATGGGG + Intronic
1074799058 10:116980465-116980487 TTAAATTTCTTGTAGAGATGGGG + Intronic
1074849843 10:117430949-117430971 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1075208083 10:120463979-120464001 TTTTATTTTTTGAAGAGATGGGG + Intronic
1075390901 10:122090911-122090933 TTTAATTTTTTGTAGAGATGGGG + Intronic
1075803203 10:125165957-125165979 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1075869212 10:125756983-125757005 TTTAATTTTTTGTAGAGATGGGG + Intronic
1076011134 10:126989497-126989519 TTTTAATTTTTGAAGAGATGAGG + Intronic
1076042713 10:127264839-127264861 TTTATTTTCTTGGAGAGATGGGG + Intronic
1076400403 10:130180261-130180283 TTTTATTTCTTGTAGAGATGAGG + Exonic
1077371543 11:2184361-2184383 TTTAATTTCTTGTAGAGATAGGG + Intergenic
1077958470 11:7047476-7047498 TTTAATTTTTTGTAGAGATGTGG + Intronic
1078502366 11:11893602-11893624 TTTAAATTTTTGTAGAGATGAGG + Intronic
1078607837 11:12792881-12792903 TTTAATTTTTTGTAGAGATGGGG - Intronic
1078614102 11:12848771-12848793 TTTAATTTTTTGTAGAGATGGGG - Intronic
1078957847 11:16222384-16222406 TTTAATTTTTTGTAGAGATGGGG + Intronic
1079194814 11:18316120-18316142 TTAAAGTTTTTGTAGAGATGGGG - Intronic
1079789901 11:24723652-24723674 TTTAATTTTTTGTAGAGATGGGG - Intronic
1080277482 11:30519107-30519129 TTTAATTTTTTGTAGAGATGGGG - Intronic
1080370418 11:31633408-31633430 TTTAATTTTTTGTAGAGATGGGG - Intronic
1080507529 11:32931404-32931426 TTTAAATTTTTGTAGAGATGGGG - Intronic
1080521315 11:33070101-33070123 TTTAATTTTTTGTAGAGATGGGG - Intronic
1080547122 11:33331545-33331567 TTTAATTTTTTGTAGAGATGGGG + Intronic
1080911282 11:36601824-36601846 TTTAATTTTTTGTAGAGATGAGG + Intronic
1081058567 11:38443220-38443242 CTTAAATTCATGAAGTGTTGAGG - Intergenic
1081310389 11:41563441-41563463 TTTTATTTCTTGTAGAGATGGGG + Intergenic
1081518995 11:43863180-43863202 TTAAATTTTTTGAAGAGATGGGG - Intergenic
1081545483 11:44068423-44068445 TTTACCTTTTTGTAGTGATGGGG - Intronic
1081680565 11:44999559-44999581 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1081889064 11:46525126-46525148 TTAAATTTCTTGTAGAGATGAGG - Intronic
1081927585 11:46843556-46843578 TTTTAGTTTTTGTAGCGATGGGG - Intronic
1082032927 11:47619628-47619650 TTTAATTTCTTGTAGAGATGGGG - Intronic
1082054215 11:47799716-47799738 TTTAATTTTTTGTAGAGATGGGG + Intronic
1082054564 11:47802800-47802822 TTTAATTTTTTGTAGAGATGGGG - Intronic
1082065764 11:47898977-47898999 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1082217017 11:49583647-49583669 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1082840873 11:57688900-57688922 TTTTACTTTTTGTAGTGATGAGG + Intronic
1083224309 11:61274887-61274909 TTAAAGTTTTTGTAGAGATGGGG - Intronic
1083323354 11:61861033-61861055 TTTAAGTTTTTATAGAGATGGGG - Intronic
1083466191 11:62847913-62847935 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1083473224 11:62898382-62898404 TTTAACTTTTTGTAGAGATGGGG + Intergenic
1083782978 11:64927530-64927552 TTTAAATTTTTGTAGTGATGCGG - Intronic
1083805162 11:65069065-65069087 TTTAATTTTTTGCAGAGATGGGG - Intronic
1083977022 11:66130896-66130918 TTTAATTTCTGGCAGAGATGAGG - Intronic
1084045451 11:66565412-66565434 TTTAATTTTTTGTAGAGATGGGG + Intronic
1084752203 11:71211364-71211386 TTTATGTTTTTGTAGAGATGGGG - Intronic
1084781337 11:71411519-71411541 TTTAATTTGTTGTAGAGATGGGG - Intergenic
1085057705 11:73416770-73416792 TTTAATTTTTTGTAGAGATGGGG - Intronic
1085144674 11:74183122-74183144 TTTAACTTTTTGTAGCGATGTGG - Intronic
1085377510 11:76079309-76079331 TTTAATTTTTTGTAGAGATGAGG - Intronic
1085553265 11:77395180-77395202 CCTAACTTCTTGAAGTGATGAGG - Intronic
1086093349 11:83026015-83026037 TTAATTTTCTTGAAGAGATGGGG - Intronic
1086389029 11:86341650-86341672 TTTAATTTTTTGTAGAGATGGGG + Intronic
1086428847 11:86715836-86715858 TTTATTTTTTTGTAGTGATGGGG - Intergenic
1086534651 11:87830307-87830329 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1086632535 11:89040520-89040542 TTTAATTTTTTGTAGAGATGAGG - Intronic
1087037016 11:93766054-93766076 TTTTAGTTTTTGTAGAGATGGGG - Intronic
1087857888 11:103114490-103114512 TTTTAGTTCTTGTAGAGATGGGG + Intronic
1088237816 11:107743959-107743981 TTAAAGGTCTTGAAGGGAGGAGG - Intergenic
1088276433 11:108091515-108091537 TTTAAATTTTTGTAGAGATGGGG - Intronic
1088288560 11:108211775-108211797 TTTAATTTTTTGCAGAGATGGGG - Intronic
1088299277 11:108338480-108338502 TTTAATTTTTTGTAGAGATGAGG - Intronic
1088303891 11:108387698-108387720 TTTAATTTTTTGTAGAGATGGGG + Intronic
1088328593 11:108627319-108627341 TTTAAATTTTTGTAGAGATGGGG - Intergenic
1088601796 11:111486262-111486284 TTTGAGTTTTTGTAGAGATGGGG - Intronic
1088868130 11:113868748-113868770 TTTTAGTTTTTGTAGAGATGGGG - Intronic
1088941640 11:114464283-114464305 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1089050826 11:115544306-115544328 TTTCAGTTAATGAAGAGATGGGG - Intergenic
1089238539 11:117053817-117053839 TTTTAGTTTTTGTAGAGATGGGG + Intronic
1089450369 11:118590987-118591009 TTTAAGTTTTTGTAGAGATAGGG - Intronic
1089627095 11:119758158-119758180 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
1089661223 11:119986930-119986952 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1090361842 11:126178130-126178152 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1090772425 11:129932938-129932960 TTTAATTTTTTGTAGAGATGGGG + Intronic
1090786779 11:130056303-130056325 TTTAATTTTTTGTAGAGATGTGG + Intergenic
1091054436 11:132405163-132405185 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1091446876 12:548735-548757 TTTAATTTTTTGTAGAGATGAGG - Intronic
1091451916 12:577726-577748 TTTAAATTTTTGTAGAGATGGGG + Intronic
1091479529 12:813059-813081 TTTAATTTTTTGTAGAGATGAGG - Intronic
1091491164 12:933942-933964 TTAAATTTTTTGTAGTGATGGGG - Intronic
1091536123 12:1411389-1411411 TTAAACTTCTTAAAATGATGAGG + Intronic
1091545498 12:1498961-1498983 TTTAAACTCTTGTAGAGATGAGG + Intergenic
1091774194 12:3173665-3173687 TTTAAGTTTTTGTAGAGATGGGG + Intronic
1091892644 12:4072409-4072431 TTTAATTTCTTGTAGAAATGGGG + Intergenic
1092308529 12:7326380-7326402 TTTAAGTCTTTGTAGAGATGGGG + Intronic
1092343067 12:7692813-7692835 TTTAAGTTTTTGTAGAGATAGGG + Intronic
1092790667 12:12068114-12068136 TTTATTTTTTTGTAGTGATGGGG + Intronic
1093731734 12:22573059-22573081 TTTAATTTTTTGTAGAGATGAGG - Intergenic
1093737046 12:22632673-22632695 TTAAATTTTTTGTAGTGATGTGG + Intronic
1094151488 12:27289034-27289056 TATAAGTATTTGAAGTTATGTGG + Intronic
1094223579 12:28021504-28021526 TTAAATTTCTTGTAGAGATGGGG + Intergenic
1094361568 12:29636870-29636892 TTTAATTTTTTGTAGAGATGAGG - Intronic
1094425182 12:30309862-30309884 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
1094444371 12:30513831-30513853 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1095136967 12:38616319-38616341 TTTAAGTTCTTTAAGTTTTAGGG + Intergenic
1095391164 12:41708201-41708223 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1095563765 12:43596376-43596398 TTTAATTTTTTGCAGAGATGAGG - Intergenic
1095576790 12:43749508-43749530 TTTAATTTTTTGTAGAGATGGGG - Intronic
1095744203 12:45639550-45639572 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1095904456 12:47363249-47363271 TTTAAGTTCTTAAAGGTATTTGG - Intergenic
1095919883 12:47518382-47518404 TTGTAGTTCTTGTAGAGATGGGG + Intergenic
1096049601 12:48595752-48595774 TTTAATTTTTTGTAGTCATGGGG - Intergenic
1096145130 12:49273558-49273580 TTTTATTTCTTGTAGAGATGGGG + Exonic
1096174347 12:49502627-49502649 TTTAATTTTTTGTAGAGATGAGG + Intronic
1096266553 12:50127553-50127575 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1096320316 12:50606291-50606313 TTTTAGTTTTTGTAGAGATGAGG + Intronic
1096326162 12:50663695-50663717 TTTAATTTTTTGTAGAGATGGGG - Intronic
1096373987 12:51092473-51092495 TTTAACTTTTTGTAGAGATGGGG + Intergenic
1096487323 12:51992330-51992352 TTTTATTTCTTGTAGAGATGGGG - Intronic
1096621453 12:52868086-52868108 TTTGTCTTCTTGAAGAGATGCGG - Intergenic
1096833887 12:54335850-54335872 TTTAAGTTCTTGCAGAGACAGGG + Intronic
1097773545 12:63619266-63619288 TTTAATTTTTTGTAGCGATGAGG - Intronic
1097814670 12:64059400-64059422 TTTAAGTTGTTTAAGAGATTTGG + Intronic
1097836241 12:64275638-64275660 TTTAATTTTTTGTAGAGATGAGG + Intronic
1098064792 12:66602394-66602416 TTTAATTTCTTTAAATTATGCGG - Intronic
1098167927 12:67717421-67717443 TTTTATTTCTTGTAGAGATGGGG - Intergenic
1099138556 12:78940564-78940586 TTTAATTTTTTGTAGAGATGGGG + Intronic
1099150258 12:79102508-79102530 TTTTAGTTATTGAAGTGCTAAGG - Intronic
1099358828 12:81671814-81671836 TTGAAGTTCGCCAAGTGATGGGG - Intronic
1100326860 12:93548252-93548274 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1100484045 12:95007767-95007789 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1100488306 12:95053144-95053166 TTTAATTTTTTGTAGAGATGGGG + Intronic
1100542609 12:95572224-95572246 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1100635953 12:96434817-96434839 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1100709448 12:97239565-97239587 TTAAAGTTTTTGTAGAGATGGGG - Intergenic
1100878128 12:98984835-98984857 TTTAATTTTTTGCAGTGTTGGGG - Intronic
1101190882 12:102331099-102331121 TTTTATTTCTTGTAGAGATGGGG + Intergenic
1101595420 12:106160338-106160360 TTTTAGTTTTTGCAGAGATGGGG + Intergenic
1101868753 12:108544735-108544757 TTTTAGTTCTTGTAGAGATGGGG + Intronic
1101952499 12:109187630-109187652 TTTAATTTTTTGTAGAGATGGGG + Intronic
1102051851 12:109868181-109868203 TTTAATTTTTTGTAGAGATGGGG + Intronic
1102130304 12:110523260-110523282 TTTAAGTTTTTGTTGAGATGGGG - Intronic
1102185194 12:110942205-110942227 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1102303926 12:111790880-111790902 TTTAATTTTTTGTAGAGATGGGG - Intronic
1102319672 12:111920849-111920871 TTTAATTTTTTGAAGAGATGGGG - Intergenic
1102377577 12:112435190-112435212 TTTAATTTTTTGTAGAGATGGGG + Intronic
1102460878 12:113098838-113098860 TTTAAATTTTTGTAGAGATGGGG - Exonic
1102472428 12:113167202-113167224 TTTAATTTTTTGTAGAGATGGGG - Intronic
1102694528 12:114787805-114787827 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1102795847 12:115688201-115688223 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1102958298 12:117074050-117074072 TTAAAGTTTTTGTAGAGATGGGG - Intronic
1103054825 12:117810483-117810505 TTTAATTTCTTGTAGAGATGAGG + Intronic
1103078138 12:118001493-118001515 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1103224047 12:119271415-119271437 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1103294570 12:119875569-119875591 TTTAATTTTTTGTAGGGATGGGG - Intronic
1103316853 12:120063141-120063163 TTTCAGTCAGTGAAGTGATGGGG - Intronic
1103425293 12:120828932-120828954 TTTTATTTCTTGTAGAGATGGGG + Intronic
1103607545 12:122098324-122098346 TTTAGGTTCTTGGAAAGATGGGG + Intronic
1103670295 12:122608884-122608906 TTTAAATTTTTGTAGAGATGGGG - Intronic
1103711968 12:122919342-122919364 TTTAAATTTTTGTAGGGATGGGG + Intergenic
1103759304 12:123236419-123236441 TTTAATTTTTTGTAGAGATGGGG - Intronic
1103871762 12:124097328-124097350 TTTAATTTTTTGTAGAGATGGGG + Intronic
1104061925 12:125275884-125275906 TTTAAGTTTTTGTAGAAATGGGG + Intronic
1104092725 12:125529267-125529289 TTTAATTTTTTGTAGAGATGAGG + Intronic
1104690597 12:130823128-130823150 TTAAAGTTTTTGTAGAGATGGGG - Intronic
1104702256 12:130915929-130915951 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1105044415 12:132990109-132990131 TTTAATTTTTTGTAGAGATGGGG - Intronic
1105374511 13:19831295-19831317 TTTAATTTTTTGTAGAGATGGGG + Intronic
1105391285 13:19981097-19981119 TTTTATTTCTTGTAGAGATGAGG - Intronic
1105553092 13:21416867-21416889 TTTTAGTTCATGAAGGGATTTGG + Intronic
1105560363 13:21484764-21484786 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1105730050 13:23203858-23203880 TTTGGATTCTTAAAGTGATGTGG + Exonic
1105744020 13:23360043-23360065 TTTAGTTTCTGGAAGTGCTGTGG - Intronic
1105784193 13:23732159-23732181 TTAAACTTCTTGTAGAGATGGGG + Intronic
1106008320 13:25792736-25792758 TTTTAGTTTTTGTAGAGATGAGG - Intronic
1106121222 13:26861528-26861550 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
1106260854 13:28065467-28065489 TTTAATTTTTTGTAGAGATGGGG - Intronic
1106262755 13:28082332-28082354 TTTAACTTTTTGTAGAGATGGGG + Intronic
1106497636 13:30295589-30295611 TTTAATTTTTTGTAGAGATGGGG - Intronic
1106875590 13:34068730-34068752 TTTTATTTTTTGTAGTGATGGGG - Intergenic
1106889430 13:34227427-34227449 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1106901782 13:34361201-34361223 TTTAACTTCTAGAAGTGCTTTGG + Intergenic
1107145169 13:37053661-37053683 TTTAAGTTCTGGAATACATGTGG - Intronic
1107444964 13:40462206-40462228 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1107603422 13:42036548-42036570 TTTAAGATCTTGAAAAGAAGGGG + Intergenic
1107614360 13:42149099-42149121 TTTGAGTTTTTGTAGAGATGGGG + Intronic
1107842777 13:44476837-44476859 TTTAATTTTTTGTAGAGATGGGG + Intronic
1107858488 13:44638386-44638408 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1108204815 13:48077581-48077603 TTAAAGTTTTTGTAGAGATGAGG + Intronic
1108208363 13:48113770-48113792 TTTAGTTTCTTGTAGAGATGAGG - Intergenic
1108410577 13:50142613-50142635 TTTAAGTTTTTGTAGAGATAGGG - Intronic
1108568485 13:51725864-51725886 TTTTAGTTTTTGTAGAGATGAGG + Intronic
1108616452 13:52138192-52138214 TTTAATTTTTTGTAGAGATGGGG + Intronic
1108754547 13:53484249-53484271 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1109116158 13:58388668-58388690 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1109356830 13:61240847-61240869 TTGTTTTTCTTGAAGTGATGGGG - Intergenic
1109678478 13:65713477-65713499 TTTAATTACTTGAAGTAATAGGG + Intergenic
1109800860 13:67376841-67376863 TTTGAGTTATAGAAGTGAGGAGG - Intergenic
1110109041 13:71719690-71719712 TTAAATTTTTTGTAGTGATGGGG - Intronic
1110237491 13:73231980-73232002 TTTAATTTTTTGTAATGATGGGG + Intergenic
1110255464 13:73429111-73429133 TTTTATTTCTTGATTTGATGAGG - Intergenic
1110279676 13:73678497-73678519 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
1110621224 13:77598131-77598153 TTTAATTTTTTGTAGAGATGGGG + Intronic
1111570422 13:90077557-90077579 TTTAAGTTCTGGAATACATGTGG + Intergenic
1111664414 13:91249130-91249152 TTTCAGTTTTTGTAGAGATGGGG + Intergenic
1111666966 13:91281842-91281864 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1111942296 13:94623507-94623529 TTTAATTTTTTGTAGAGATGGGG - Intronic
1112148603 13:96730738-96730760 TTTAAATTTTTGTAGAGATGCGG + Intronic
1112148628 13:96730902-96730924 TTTAAATTTTTGTAGAGATGAGG + Intronic
1112222787 13:97508080-97508102 TTTTATTTCTTGTAGAGATGGGG - Intergenic
1112277581 13:98035670-98035692 TTTGAAGTCTTGAAGTCATGGGG - Intergenic
1112339145 13:98538115-98538137 AGGAAGTTCTGGAAGTGATGAGG - Intronic
1112594729 13:100797290-100797312 TTTTAGTTTTTGTAGAGATGAGG - Intergenic
1112859419 13:103811984-103812006 TTAATGTTCTTGTAGAGATGAGG - Intergenic
1113075046 13:106459918-106459940 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1113247089 13:108409164-108409186 TTTAAGTTTTTGTAGAGATGGGG - Intergenic
1113726209 13:112604468-112604490 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1113842531 13:113368437-113368459 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
1114225012 14:20729984-20730006 TTTAATTTTTTGTAGAGATGAGG - Intergenic
1114300089 14:21368091-21368113 TTTAATTTCTTGTAGAGATATGG + Intronic
1114561670 14:23596658-23596680 TTTTAGTTTTTGTAGAGATGTGG + Intergenic
1114776428 14:25487625-25487647 TTTTATTTCTTGTAGAGATGGGG + Intergenic
1114895188 14:26980573-26980595 TTTAATTTCTTGTAGAGTTGGGG - Intergenic
1115092751 14:29598101-29598123 TTTAATTTTTTGTAGAGATGGGG - Intronic
1115221735 14:31064780-31064802 TTTAACTTTTTGTAGAGATGAGG - Intronic
1115246809 14:31304030-31304052 TTTAATTTTTTGTAGAGATGGGG - Intronic
1115542120 14:34430697-34430719 TTTAAGTTTTTGTAGAGATGGGG + Intronic
1115621507 14:35145141-35145163 TTTAATTTTTTGTAGAGATGGGG + Intronic
1115671061 14:35612197-35612219 TTTAAATTTTTGTAGAGATGAGG - Intronic
1116124050 14:40758658-40758680 TTTAATTTGTTGCAGTGAGGTGG + Intergenic
1116259795 14:42610063-42610085 TTTCAGTTCTGGAAGTTTTGAGG + Intergenic
1116979188 14:51149943-51149965 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1117114610 14:52496780-52496802 TTTATGTTTTTGTAGAGATGGGG + Intronic
1117363362 14:54999777-54999799 TTTAATTTTTTGTAGAGATGGGG + Intronic
1117401556 14:55363205-55363227 TTTAATTTCTAGTAGAGATGGGG + Intergenic
1117427194 14:55612878-55612900 TTTAATTTCTTGTAGAGATGAGG - Intronic
1117656806 14:57963893-57963915 TTTAATTTTTTGCAGAGATGGGG + Intronic
1117695168 14:58354509-58354531 TTTAATTTTTTGTAGAGATGGGG - Intronic
1117894119 14:60462200-60462222 TTTAATTTTTTGTAGAGATGGGG - Intronic
1118271944 14:64351646-64351668 TTGAAGTTTTTGTAGAGATGAGG - Intergenic
1118291577 14:64529597-64529619 TTTAAATTTTTGTAGAGATGGGG - Intronic
1118596125 14:67436881-67436903 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1118802575 14:69204396-69204418 TTTGATTTCTTGTAGAGATGCGG - Intronic
1118834083 14:69463759-69463781 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1118850842 14:69582176-69582198 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1118990918 14:70796307-70796329 CTTAAGTTAATGATGTGATGTGG + Intronic
1119105988 14:71924215-71924237 TTTAAATTTTTGTAGCGATGCGG + Intergenic
1119587569 14:75850920-75850942 TTTTATTTCTTGTAGAGATGAGG - Intronic
1119628508 14:76205140-76205162 TTTAAGTTTTTGGAGAGATGGGG + Exonic
1120012740 14:79435804-79435826 TTTAATTTTTTGTAGAGATGAGG + Intronic
1120803456 14:88719210-88719232 TTTAATTTTTTGTAGAGATGTGG - Intronic
1120846100 14:89126328-89126350 TTTAATTTTTTGTAGAGATGGGG - Intronic
1120940736 14:89946577-89946599 ATTAAGTTTTTTAAGAGATGAGG + Intronic
1121095392 14:91214836-91214858 TTTAATTTTTTTTAGTGATGGGG - Intronic
1121175532 14:91888124-91888146 TTAAATTTTTTGAAGAGATGGGG - Intronic
1121193964 14:92053669-92053691 TTTTATTTCTTGTAGAGATGAGG + Exonic
1121243405 14:92446317-92446339 TTTAATTTTTTGTAGAGATGGGG + Intronic
1121354194 14:93199999-93200021 TTTAATTTTTTGTAGAGATGGGG - Intronic
1121447024 14:93985363-93985385 TTTACATTCTTTAAGTGAAGAGG + Intergenic
1121621216 14:95349656-95349678 TTAAAGTTTTTGTAGAGATGGGG - Intergenic
1122139705 14:99655449-99655471 TTTAATTTTTTGTAGAGATGAGG - Intronic
1122204152 14:100140079-100140101 TTTAACTTTTTGTAGAGATGGGG - Intronic
1122490820 14:102114825-102114847 TTTTAGTTCTAGTAGAGATGAGG - Intronic
1122528085 14:102404074-102404096 TTTAATTTTTTGTAGAGATGGGG + Intronic
1122549342 14:102541396-102541418 TTTAAGTTTTTGTAGAGATGGGG + Intergenic
1122703571 14:103606349-103606371 TTTAATTTTTTGTAGAGATGGGG - Intronic
1122966980 14:105135654-105135676 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1123051030 14:105542558-105542580 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1202830921 14_GL000009v2_random:28917-28939 TTTAAGTTCCGGTAGTGATAGGG - Intergenic
1123434018 15:20241827-20241849 TTTTATTTCTTGTAGAGATGGGG - Intergenic
1123450137 15:20354660-20354682 TTTATGTTTTTGTAGAGATGGGG - Intergenic
1123691747 15:22843829-22843851 TTTATGTTTTTGTAGAGATGGGG + Intronic
1123757936 15:23411603-23411625 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1124087671 15:26566551-26566573 TTTAATTTTTTGTAGAGATGGGG - Intronic
1124106408 15:26741779-26741801 TTTAATTTTTTGTAGAGATGGGG + Intronic
1124401465 15:29352105-29352127 TTAAATTTTTTGTAGTGATGTGG + Intronic
1124873624 15:33568601-33568623 TTTAATTTTTTGTAGAGATGGGG + Intronic
1124908538 15:33895496-33895518 TTTTATTTTTTGAAGAGATGAGG + Intronic
1124990158 15:34665185-34665207 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
1125701246 15:41686352-41686374 TTTAAGTTTTTATAGAGATGGGG - Intronic
1125757699 15:42075094-42075116 TTTAACTTTTTGTAGAGATGGGG + Intronic
1125842569 15:42818080-42818102 TTTAATTTTTTTAAGAGATGAGG + Intronic
1125843949 15:42833698-42833720 TTTAATATTTTGTAGTGATGAGG - Intronic
1125916003 15:43488124-43488146 TTTAACTTTTTGTAGAGATGGGG - Intronic
1125934685 15:43624945-43624967 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1125952548 15:43765202-43765224 TTTAAATTTTTGTAGAGATGGGG - Intronic
1126121862 15:45260582-45260604 TTTAAATTTTTGTAGAGATGAGG - Intronic
1126745128 15:51818168-51818190 ATTCAGTTCTTGGAGTGATGGGG - Intergenic
1127054375 15:55116504-55116526 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1127201374 15:56656037-56656059 TTACAGTTCTTGTAGTGATCTGG - Intronic
1127437407 15:58971750-58971772 TTTAATTTTTTGTAGAGATGGGG + Intronic
1127792723 15:62412624-62412646 TTTGAGTTCTTGAAGACCTGTGG + Intronic
1127837745 15:62804423-62804445 TTTAATTTTTTGTAGAGATGTGG - Intronic
1127985698 15:64068712-64068734 TTAAATTTCTTGTAGAGATGAGG - Intronic
1128141162 15:65301728-65301750 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1128307304 15:66607818-66607840 TTTAATTTTTTGTAGAGATGAGG + Intronic
1128452511 15:67813959-67813981 TTAAAGTTTTTGTAGAGATGAGG + Intergenic
1128603771 15:69019033-69019055 TTTAAATTTTTGTAGAGATGAGG + Intronic
1128817454 15:70623524-70623546 TTTAAATTTTTGTAGAGATGTGG + Intergenic
1128969462 15:72094684-72094706 TTTAAGTTTTTGTACAGATGAGG + Intronic
1128969863 15:72099120-72099142 TTTGAGTTTTTGTAGAGATGAGG - Intronic
1129007082 15:72382958-72382980 TTAAAGTTTTTGTAGAGATGGGG + Intergenic
1129371822 15:75101431-75101453 TTTAAGTATTTGTAGAGATGAGG - Intronic
1129430996 15:75501983-75502005 TTTTATTTTTTGAAGAGATGGGG - Intronic
1129596495 15:76968400-76968422 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1129638762 15:77352046-77352068 TTTAAATTTTTGGAGAGATGGGG - Intronic
1129784092 15:78296673-78296695 TTTAATTTTTTGTAGAGATGGGG + Intronic
1129914049 15:79252781-79252803 TTTAAGTTTTTATAGAGATGAGG + Intergenic
1130243685 15:82222497-82222519 TCTAAGTTCATGAAGTGATCTGG + Intronic
1130456789 15:84118780-84118802 CCTAAGTTCATGAAGTGATCTGG - Intergenic
1130525778 15:84705095-84705117 TTTAATTTCTTGTAGAGACGGGG + Intronic
1130602805 15:85288581-85288603 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1130611008 15:85360884-85360906 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1130924289 15:88373705-88373727 TTTTAGTTTTTGTAGAGATGTGG + Intergenic
1131068598 15:89449762-89449784 TTTAAACTTTTGAAGAGATGAGG - Intergenic
1131673140 15:94642713-94642735 TTTAAGTTTTTAATGTGTTGAGG - Intergenic
1132060255 15:98686840-98686862 TTTAAATTTTTGTAGAGATGCGG + Intronic
1132522124 16:396625-396647 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1132650320 16:1018597-1018619 TTGTATTTCTTGTAGTGATGGGG + Intergenic
1132922508 16:2405580-2405602 TTTTATTTTTTGAAGAGATGGGG - Intergenic
1132928898 16:2448584-2448606 TTTAACTTTTTGAAGAGATAGGG + Intronic
1133009292 16:2901510-2901532 TTTGAGTTTTTGAGGAGATGGGG + Intergenic
1133024950 16:2984903-2984925 TTTAATTTCTTGTAGAGACGGGG + Intergenic
1133141770 16:3750173-3750195 TTTAATTTTTTGTAGAGATGGGG + Intronic
1133151169 16:3832059-3832081 TTTAAGTTCTTGAATTGATTTGG - Intronic
1133165733 16:3946019-3946041 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
1133197086 16:4178699-4178721 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1133218701 16:4308735-4308757 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1133381883 16:5337869-5337891 TTTAATTTTTTGCAGAGATGGGG - Intergenic
1133432782 16:5752977-5752999 GTTTATTTCTTGGAGTGATGAGG - Intergenic
1133460216 16:5980936-5980958 TTCCATTTCTGGAAGTGATGTGG + Intergenic
1133464259 16:6015027-6015049 TTAAATTTCTTGTAGAGATGGGG + Intergenic
1133595210 16:7284501-7284523 TTTAACTTCTTGTAGAGATGAGG + Intronic
1133620212 16:7518848-7518870 TTAAATTTCTTGTAGAGATGAGG - Intronic
1134063113 16:11210868-11210890 TTTAACTTTTTGTAGAGATGGGG + Intergenic
1134098831 16:11437384-11437406 TTTAATTTTTTGTAGAGATGCGG - Intronic
1134258577 16:12631571-12631593 TTTATTTTTTTGTAGTGATGGGG - Intergenic
1134411937 16:14010471-14010493 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1134414676 16:14033225-14033247 TTTAAATTTTTGTAGAGATGGGG - Intergenic
1134415606 16:14040939-14040961 TTAAAGTTTTTGTAGAGATGGGG - Intergenic
1134458409 16:14411315-14411337 TTTAAATTTTTGTAGAGATGGGG - Intergenic
1134623000 16:15703758-15703780 TTTAAATTCTTGTATAGATGAGG + Exonic
1134895440 16:17882257-17882279 TTTTTTTTCTTGAAGAGATGGGG + Intergenic
1135078233 16:19412241-19412263 TTTAAATTTTTGTAGAGATGGGG + Intronic
1135174818 16:20218548-20218570 TTAAAGATCCAGAAGTGATGGGG + Intergenic
1135255731 16:20940233-20940255 TTTATTTTCTTTAAGAGATGGGG + Intronic
1135648407 16:24184281-24184303 TTTAATTTTTTGTAGGGATGGGG - Intronic
1135746766 16:25023795-25023817 TTTATTTTTTTGAAGAGATGAGG + Intergenic
1136005530 16:27326492-27326514 TTTAAATTTTTGTAGAGATGGGG - Intronic
1136036357 16:27543568-27543590 TTTAATTTTTTGTAGTGATGGGG + Intronic
1136238144 16:28927357-28927379 TTTAATTTTTTGTAGAGATGAGG - Intronic
1136532756 16:30880872-30880894 TTTAAGTTTTTGTAGAGATGAGG + Intronic
1136581047 16:31150881-31150903 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1136850595 16:33609288-33609310 TTTTATTTCTTGTAGAGATGGGG + Intergenic
1137630639 16:49941312-49941334 TTTAATTTTTTGCAGAGATGAGG - Intergenic
1137644435 16:50061873-50061895 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1137975096 16:53024543-53024565 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1138487591 16:57356692-57356714 TTTTATTTCTTGTAGAGATGGGG - Intergenic
1139013459 16:62661775-62661797 TTTTATTTCTTGTAGAGATGGGG + Intergenic
1139021665 16:62757599-62757621 ATTAATATCTTGAAGTGTTGAGG + Intergenic
1139347542 16:66313814-66313836 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1139733376 16:68967086-68967108 TTTAAATTTTTGTAGAGATGGGG + Intronic
1140009194 16:71113764-71113786 TTTAATTTTTTGTAGAGATGGGG + Intronic
1140042331 16:71416314-71416336 TTTAATTTTTTGTAGAGATGCGG + Intergenic
1140212376 16:72980584-72980606 TTTAACTTTTGGTAGTGATGGGG - Intronic
1140232841 16:73132111-73132133 TTTAAATTTTTGTAGAGATGGGG - Intronic
1140265196 16:73414662-73414684 TTTAAATTTTTGTAGAGATGGGG - Intergenic
1140793884 16:78417263-78417285 TTTAATTTTTTGTAGAGATGAGG + Intronic
1140868549 16:79085871-79085893 TTTTATTTTTTGTAGTGATGAGG - Intronic
1141105199 16:81227597-81227619 TTTAAGTTTTTATAGAGATGGGG + Intergenic
1141148484 16:81548304-81548326 TTAAAGTTTTTGTAGAGATGGGG + Intronic
1141207505 16:81944645-81944667 TTTTATTTCTTGTAGAGATGGGG + Intronic
1141529895 16:84638895-84638917 TTTAATTTCTTGCAGAGAAGAGG - Intergenic
1141624873 16:85255858-85255880 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1141820962 16:86445386-86445408 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1142028411 16:87826583-87826605 TTTAACTTTTTGTAGAGATGGGG - Intergenic
1203112209 16_KI270728v1_random:1457737-1457759 TTTTATTTCTTGTAGAGATGGGG + Intergenic
1142476022 17:190707-190729 TTTTATTTTTTGTAGTGATGGGG - Intergenic
1143025448 17:3938992-3939014 TTTAATTTTTTGTAGAGATGAGG - Intronic
1143700606 17:8657064-8657086 TTTTACTTCTTGTAGAGATGGGG - Intergenic
1143965052 17:10751087-10751109 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1144333117 17:14242504-14242526 TTTAATTTTTTTAAGAGATGAGG + Intergenic
1145836724 17:27959988-27960010 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1145860735 17:28207879-28207901 TTTATTTTCTTGTAGAGATGGGG + Intergenic
1146010938 17:29193950-29193972 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1146051746 17:29559630-29559652 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1146209591 17:30931647-30931669 TTTAAATTTTTGTAGAGATGGGG - Intronic
1146292909 17:31624245-31624267 TTTAATTTTTTGTAGAGATGTGG - Intergenic
1146371806 17:32269173-32269195 TTTAATTTTTTGTAGAGATGAGG - Intronic
1146378640 17:32312261-32312283 TTTAAATTTTTGTAGAGATGGGG - Intronic
1146704462 17:34990768-34990790 TTTAATTTTTTGTAGAGATGGGG + Intronic
1146822997 17:35999634-35999656 TTTACCTTTTTGTAGTGATGAGG + Intronic
1146859021 17:36280239-36280261 TTTAAATTTTTGTAGAGATGGGG + Intronic
1146963882 17:37008689-37008711 TTCCAGTTCTTGTAGAGATGGGG - Intronic
1146987872 17:37238999-37239021 TTTAATTTTTTGTAGAGATGGGG + Intronic
1147089343 17:38084325-38084347 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1147107868 17:38236193-38236215 TTTAAATTTTTGTAGAGATGGGG - Intergenic
1147157815 17:38553080-38553102 TTTATTTTTTTGTAGTGATGAGG - Intronic
1147233442 17:39037380-39037402 TTTAATTTTTTGTAGAGATGTGG - Intergenic
1147319766 17:39638965-39638987 TTTAAATTTTTGTAGCGATGGGG - Intronic
1147770081 17:42861461-42861483 TTTAAGTTATTGTAGAGATGAGG + Intergenic
1148084610 17:44986468-44986490 TTTAAGTTTTTGTAGAGATGGGG + Intergenic
1148128692 17:45249660-45249682 TTTAATTTGTTGTAGAGATGGGG + Intergenic
1148132700 17:45271515-45271537 TTTATGTTTTTGTAGAGATGGGG + Intronic
1148421525 17:47551640-47551662 TTTAAATTTTTGTAGAGATGGGG + Intronic
1148640970 17:49187035-49187057 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1148982568 17:51591433-51591455 TTTAATTTTTTGTAGAGATGAGG - Intergenic
1149148460 17:53529524-53529546 TTTAAATGCTTGAAGACATGTGG - Intergenic
1149318634 17:55462436-55462458 TTTAAATTTTTGTAGGGATGAGG - Intergenic
1149401632 17:56302350-56302372 TTTAATTTTTTGTAGAGATGAGG - Intronic
1149479460 17:56990941-56990963 TTTAACTTTTTGTAGAGATGGGG + Intronic
1149632278 17:58136217-58136239 TTTAATTTTTTGAGGAGATGGGG + Intergenic
1149670824 17:58408169-58408191 TTTAATTTCTTGAAATAATTGGG + Intronic
1149808472 17:59641858-59641880 TTAAAGTTTTTGCAGAGATGGGG + Intronic
1149819741 17:59764494-59764516 TTTAAATTTTTGTAGAGATGAGG + Intronic
1150042680 17:61880577-61880599 TTTTAGTTTTTGTAGAGATGGGG - Intronic
1150064483 17:62097539-62097561 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1150114928 17:62539101-62539123 TATAAATTGTTGAAGTCATGTGG + Intronic
1150226324 17:63526527-63526549 TTTAATTTTTTGTAGGGATGGGG + Intronic
1150669341 17:67177123-67177145 TTTAACTTTTTGTAGAGATGAGG + Intronic
1150684373 17:67308799-67308821 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1150831621 17:68526255-68526277 TTTAAGTGCTTAAAGTTATTTGG + Intronic
1150880545 17:69020953-69020975 TTTATGTTCTTGAAGGGTAGAGG - Intronic
1150905595 17:69333341-69333363 TTTAATTTTCTGTAGTGATGGGG + Intergenic
1150908836 17:69367022-69367044 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1151052495 17:70994393-70994415 TTTAAATTTATGAAGTGGTGAGG + Intergenic
1151174750 17:72278000-72278022 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1151239460 17:72746441-72746463 TTTAATTTTTTGTAGAGATGGGG - Intronic
1151282109 17:73084263-73084285 TTTGAGTTTTTGCAGAGATGGGG - Intronic
1151930488 17:77228844-77228866 TTTTATCTCTTGTAGTGATGGGG + Intergenic
1152182089 17:78828831-78828853 TTTAATTTTTTGTAGAGATGGGG - Intronic
1152196015 17:78918824-78918846 TTTAATTTTTTGTAGAGATGGGG - Intronic
1152415894 17:80161644-80161666 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1152448286 17:80359351-80359373 TTAAATTTTTTGTAGTGATGGGG - Intronic
1152777074 17:82208706-82208728 TTAAATTTCTTGTAGAGATGGGG + Intronic
1153033980 18:741411-741433 TTTTAGTTTTTGTAGAGATGGGG + Intronic
1153039068 18:793507-793529 TTTAATTTTTTGCAGAGATGGGG + Intronic
1153254851 18:3160356-3160378 TTTCAGTTTTTGTAGAGATGGGG + Intronic
1153270749 18:3318863-3318885 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1153437593 18:5084370-5084392 TTTAATTTATTGTAGAGATGGGG - Intergenic
1153802005 18:8679618-8679640 TTTTATTTTTTGTAGTGATGAGG + Intergenic
1153916607 18:9751211-9751233 TTTTATTTTTTGTAGTGATGAGG + Intronic
1153948383 18:10036833-10036855 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1153998692 18:10464591-10464613 TTTATTTTCTTGTAGAGATGGGG + Intronic
1154010299 18:10568456-10568478 TTTATGTTTTTGTAGAGATGGGG - Intergenic
1154331505 18:13432887-13432909 TTTAATTTTTTGTAGAGATGGGG + Intronic
1155028746 18:21965719-21965741 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1155048698 18:22127817-22127839 TTTAATTTTTTGTAGAGATGAGG - Intergenic
1155211520 18:23606290-23606312 TTTAATTTCTTAAAGAGATGAGG + Intronic
1155505893 18:26532434-26532456 TTTAAATTTTTGTAGAGATGGGG + Intronic
1155593735 18:27458005-27458027 TTTATGTCCTAGAAGTGAGGTGG - Intergenic
1155623316 18:27806578-27806600 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1155947244 18:31868872-31868894 TTTAAATTTTTGTAGAGATGGGG + Intronic
1155989050 18:32260435-32260457 TTTAATTTTTTGTAGAGATGGGG - Intronic
1156620944 18:38850847-38850869 TCTAACTACCTGAAGTGATGTGG - Intergenic
1156726810 18:40138597-40138619 TTCATTTTCTTAAAGTGATGAGG + Intergenic
1157213924 18:45766315-45766337 TTTAAGTTCTGGGATTCATGTGG - Intergenic
1157704619 18:49793600-49793622 ATTAAATGCTTGAAGTAATGAGG - Intronic
1157750247 18:50172106-50172128 TTAAAGTTTTTGTAGAGATGGGG - Intronic
1158001139 18:52620565-52620587 TTTTTGTTCTTGAAGTGATTTGG + Intronic
1158150377 18:54361162-54361184 ATTCAGTTCTTGGAGGGATGTGG + Intronic
1158342841 18:56485261-56485283 TTTAATTTTTTTAAGAGATGAGG - Intergenic
1158415281 18:57244879-57244901 TTTAAGTTTTTGTACAGATGGGG + Intergenic
1158493485 18:57931599-57931621 TTTTTGTTTTTGTAGTGATGGGG + Intergenic
1158501606 18:58007395-58007417 TGTAAGTTCTTTAAGGGAAGAGG + Intergenic
1158531428 18:58265733-58265755 TTTTAGTTTTTGTAGAGATGGGG + Intronic
1158709914 18:59828380-59828402 TTTAACTTTTTGTAGGGATGAGG - Intergenic
1159057571 18:63481339-63481361 TTTAAGATCTTAATGTGCTGAGG - Intronic
1160369636 18:78361504-78361526 TTTAAGTTTTTGTAGAGATGGGG - Intergenic
1160473676 18:79164095-79164117 TTTTAGTTTTTGTAGAGATGGGG + Intronic
1160513312 18:79464875-79464897 TTTAAATTTTTGTAGAGATGGGG + Intronic
1160720496 19:595027-595049 TTTAACTTTTTGTAGAGATGGGG - Intronic
1160724020 19:609591-609613 TTTAATTTTTTGTAGCGATGAGG - Intronic
1161059100 19:2205869-2205891 TTTAATTTTTTGTAGAGATGGGG + Intronic
1161092770 19:2370783-2370805 TTTAAGTTTTTGTAGAGACGAGG - Intergenic
1161096130 19:2392174-2392196 TTTAATTTTTTGTAGAGATGGGG - Intronic
1161122971 19:2540321-2540343 TTTAATTTTTTGTAGAGATGGGG + Intronic
1161133248 19:2604295-2604317 TTTTATTTTTTGTAGTGATGGGG - Intronic
1161262943 19:3347568-3347590 TTTAAATTTTTGTAGAGATGGGG - Intergenic
1161523745 19:4740417-4740439 TTTAATTTTTTGCAGAGATGGGG + Intergenic
1161558188 19:4956236-4956258 TTTAATTTTTTGTAGAGATGGGG + Intronic
1161618299 19:5284772-5284794 TTTAATTTTTTGTAGAGATGGGG - Intronic
1161624076 19:5315801-5315823 TTTAACTTTTTGCAGAGATGGGG + Intronic
1161635156 19:5383919-5383941 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1161662729 19:5557171-5557193 TTTAAATTTTTGTAGAGATGGGG - Intergenic
1161696318 19:5770606-5770628 TTTAAATTTTTGTAGAGATGAGG - Intronic
1161752429 19:6108208-6108230 TTTAAGTTCTTGAATTACTAGGG - Intronic
1161786066 19:6326435-6326457 TTTAATCTTTTGTAGTGATGGGG + Intronic
1161795540 19:6384333-6384355 TTTAATTTTTTGTAGGGATGAGG - Intronic
1161853682 19:6752187-6752209 TTTCAGTTTTTGTAGAGATGAGG + Intronic
1161902979 19:7133371-7133393 AATAAGTACATGAAGTGATGAGG - Intronic
1161947192 19:7444809-7444831 TTTTATTTTTTGAAGAGATGGGG + Intronic
1161947909 19:7449848-7449870 TTTAATTTTTTGTAGAGATGGGG + Intronic
1162043648 19:7985090-7985112 TTTAATTTTTTGTAGAGATGGGG + Intronic
1162057576 19:8073850-8073872 TTTAACTTTTTGTAGAGATGGGG + Intronic
1162074554 19:8176684-8176706 TTAAAGTTTTTGTAGAGATGAGG + Intronic
1162082851 19:8229150-8229172 TTTAATTTTTTGTAGAGATGGGG - Intronic
1162210359 19:9086650-9086672 TCTTAATTCTTTAAGTGATGAGG + Intergenic
1162308094 19:9887858-9887880 TTTAATTTTTTGTAGAGATGGGG - Intronic
1162389686 19:10381830-10381852 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1162507001 19:11091396-11091418 TTTAACTTTTTGTAGAGATGAGG + Intronic
1162699577 19:12503873-12503895 TTTAATTTTTTGTAGAGATGGGG - Intronic
1162758768 19:12875853-12875875 TTTAAGTTCTAGTAGAGATGTGG + Exonic
1162906809 19:13828926-13828948 TTTAATTTTTTGTAGAGATGGGG - Intronic
1162970889 19:14180722-14180744 TTTTATTTTTTGTAGTGATGGGG + Intronic
1163058091 19:14737364-14737386 TTTAATTTTTTGTAGAGATGGGG + Intronic
1163164531 19:15486438-15486460 TTTGATTTTTTGAAGAGATGGGG + Intronic
1163254660 19:16148455-16148477 TTTAATTTTTTGTAGAGATGGGG + Intronic
1163277420 19:16294103-16294125 TTTAAGTTTTTGTAGAGATGGGG + Intergenic
1163278171 19:16298898-16298920 TTAAATTTCTTGTAGAGATGGGG - Intergenic
1163301386 19:16449099-16449121 TTTAATTTCATGTAGAGATGGGG - Intronic
1163556179 19:17994009-17994031 TTTCAGATCTTGAATTGAGGTGG - Intronic
1163582371 19:18146265-18146287 TTTAATTTTTTGCAGAGATGGGG - Intronic
1163585038 19:18159161-18159183 TTTAAATTATTTAAGAGATGGGG + Intronic
1163626475 19:18392815-18392837 TTTAATTTTTTGTAGAGATGGGG - Intronic
1163756120 19:19107143-19107165 TTTCAGTTTTTGTAGAGATGGGG - Intronic
1164457790 19:28422961-28422983 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1164487619 19:28673310-28673332 TTTTATTTCTTTAAGTAATGTGG - Intergenic
1164942065 19:32258380-32258402 TTTAAATTCTTTTAGAGATGGGG - Intergenic
1164975586 19:32570732-32570754 TTTAAATTTTTGCAGAGATGGGG + Intergenic
1165030237 19:32992945-32992967 TTTCATTTCTTGTAGAGATGGGG - Intronic
1165030557 19:32995247-32995269 TTTAATTTTTTGTAGAGATGGGG + Intronic
1165041131 19:33068421-33068443 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1165238338 19:34442060-34442082 TTAAATTTTTTGTAGTGATGGGG - Intronic
1165271321 19:34710238-34710260 TTTTAGTTTTTGTAGAGATGGGG - Intergenic
1165356357 19:35306608-35306630 TTTAATTTTTTGTAGAGATGGGG + Intronic
1165435723 19:35793695-35793717 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1165503492 19:36209002-36209024 TTTAATTTTTTGTAGAGATGGGG + Intronic
1165552245 19:36597042-36597064 TTTAATTTTTTGTAGAGATGGGG + Intronic
1165558282 19:36655424-36655446 TTTAATTTTTTGCAGAGATGAGG - Intronic
1165564521 19:36713133-36713155 TTTATCTTTTTGTAGTGATGGGG - Intronic
1165770525 19:38377361-38377383 TTTAATTTTTTGTAGAGATGGGG + Intronic
1165838937 19:38775301-38775323 TTTTATTTTTTGTAGTGATGAGG - Intergenic
1166065861 19:40358565-40358587 TTTAAGTTTTTGTAGAGATGGGG + Intronic
1166197760 19:41218253-41218275 TTAAACTTCTTGTAGAGATGGGG + Intergenic
1166313096 19:41974269-41974291 TTTAAGATTTTGTAGAGATGGGG - Intronic
1166515725 19:43445332-43445354 TCTAATTTCTTGTAGAGATGGGG - Intergenic
1166924493 19:46257578-46257600 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1167137322 19:47624864-47624886 TTTAAGTTTTTGCAGAGATGAGG + Intronic
1167287761 19:48608283-48608305 TTTAAATTTTTGTAGAGATGGGG + Intronic
1167496651 19:49823124-49823146 TTTTAATTCTTGTAGAGATGAGG + Intronic
1167585188 19:50370643-50370665 TTTAATTTTTTGTAGAGATGGGG + Intronic
1167614421 19:50524424-50524446 TTTAATTTTTTGTAGAGATGGGG + Intronic
1167750630 19:51377807-51377829 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1167799846 19:51733132-51733154 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1167838913 19:52097798-52097820 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1167850474 19:52197500-52197522 TTTAACTTTTTGTAGGGATGAGG - Intronic
1168014511 19:53561678-53561700 TTTAAATTTTTGGAGAGATGAGG - Intronic
1168020824 19:53607383-53607405 TTTAAATTTTTGTAGAGATGGGG - Intergenic
1168109007 19:54181481-54181503 TTTTATTTTTTGTAGTGATGGGG - Intronic
1168251172 19:55142989-55143011 TTTAATTTCTAGTAGAGATGGGG - Intronic
1168331257 19:55570549-55570571 TTTTATTTCTTGTAGAGATGGGG - Intergenic
1168475927 19:56675221-56675243 TTTTAGTTTTTGTAGAGATGAGG + Intergenic
1168527596 19:57101193-57101215 TTTAACTTTTTGTAGAGATGTGG - Intergenic
1202641772 1_KI270706v1_random:98858-98880 TTTAAGTTCCGGTAGTGATAGGG + Intergenic
925749148 2:7071869-7071891 TTTAAGGCCTTCAAGTGAAGTGG - Intergenic
925944162 2:8845369-8845391 TTTAATTTTTTGTAGAGATGGGG + Intergenic
926007428 2:9383430-9383452 TTAAATTTTTTGTAGTGATGGGG + Intronic
926046456 2:9713254-9713276 TTTAATTTTTTGTAGAGATGAGG - Intergenic
926665711 2:15520227-15520249 TTTAATTTTTTGAAGCGATGGGG - Intronic
926687274 2:15707856-15707878 TTTTATTTCTTGTAGAGATGGGG + Intronic
926734223 2:16060342-16060364 TTTAACTTTTTGTAGAGATGAGG - Intergenic
926785004 2:16509806-16509828 TTTATTTACCTGAAGTGATGGGG - Intergenic
927177111 2:20418105-20418127 TTTATGTTTTTGTAGAGATGAGG + Intergenic
927504707 2:23605268-23605290 TTTAATTTTTTGAAGAGACGAGG + Intronic
927528705 2:23773331-23773353 TTTAATTTTTTGCAGAGATGGGG - Intronic
927531896 2:23813561-23813583 TTTAATTTTTTGTAGAGATGGGG - Intronic
927558947 2:24055379-24055401 TTTAATTTTTTGTAGAGATGAGG + Intronic
927644595 2:24869576-24869598 TTTAATTTTTTGTAGAGATGGGG + Intronic
927732837 2:25490101-25490123 TTTAATTTTTTGTAGAGATGGGG - Intronic
927735675 2:25519188-25519210 TATATTTTTTTGAAGTGATGGGG - Intronic
927772320 2:25874314-25874336 TTTAATTTTTTGTAGAGATGGGG - Intronic
927952247 2:27179795-27179817 TTTAATTTCTAGTAGAGATGAGG + Intergenic
928018170 2:27678888-27678910 TTTAATTTTTTGTAGAGATGGGG + Intronic
928038830 2:27853191-27853213 TTTAATTTTTTGTAGAGATGGGG - Intronic
928149707 2:28815107-28815129 TTTAAATTTTTGTAGAGATGAGG - Intronic
928179566 2:29058528-29058550 TTTACATCCTTAAAGTGATGCGG + Exonic
928259056 2:29750488-29750510 TTTAATTTATTGTAGAGATGGGG - Intronic
928400647 2:30976296-30976318 TCTACGTTCTTTAAGTCATGTGG - Intronic
928526927 2:32150608-32150630 TTTAATTTTTTGTAGAGATGGGG + Intronic
928571354 2:32612222-32612244 TTTTATTACTTGGAGTGATGAGG + Intronic
928700811 2:33896699-33896721 TTTAATTTTTTGTAGAGATGGGG - Intergenic
928873077 2:36004812-36004834 TTTTAGTTTTTGTAGAGATGAGG + Intergenic
929113531 2:38425262-38425284 TTTAAATTTTTGTAGGGATGGGG + Intergenic
929357290 2:41041003-41041025 TTTAATTTTTTGTAGAGATGGGG + Intergenic
929517006 2:42612557-42612579 TTTAAGTTTAAGAAGTTATGTGG + Intronic
929566343 2:42988180-42988202 TTTAATTTTTTGTAGAGATGGGG + Intergenic
929593943 2:43164073-43164095 TTTACTTTTTTGTAGTGATGGGG - Intergenic
930165835 2:48202931-48202953 TTTAATTTTTTGTAGAGATGAGG - Intergenic
930588814 2:53302402-53302424 TTTAGGTTGTTGTAATGATGTGG - Intergenic
930676568 2:54207403-54207425 TTTAAGTTCTTCAATTGGTTGGG + Intronic
930684610 2:54294736-54294758 TTTAATTTTTTGTAGAGATGGGG - Intronic
930786442 2:55275841-55275863 TTTTAGTTTTTGTAGAGATGGGG - Intergenic
930814021 2:55574063-55574085 TTCAAGTTTTTGTAGAGATGGGG + Intronic
931298638 2:60955499-60955521 TTTAAATTTTTGTAGAGATGAGG + Intronic
931713021 2:65005819-65005841 TTTAATTTTTTGTAGTGATGGGG - Intronic
931767736 2:65471670-65471692 TTTAATTTTTTGTAGAGATGGGG - Intergenic
931876970 2:66524387-66524409 TTTAACTTTTTGTAGAGATGGGG - Intronic
932016168 2:68029123-68029145 TTTAAGCTCTCGGAGTGATGTGG + Intergenic
932246081 2:70197779-70197801 TTTAATTTTTTGTAGAGATGAGG + Intronic
932346626 2:70999924-70999946 TTTTATTTCTTGTAGAGATGGGG - Intergenic
932474464 2:71993257-71993279 TTTAATTTTTTGTAGAGATGGGG + Intergenic
932746265 2:74336239-74336261 TTTAATTTTTTGTAGAGATGAGG + Intronic
932946482 2:76238476-76238498 TTTAAATTCTTGTGGTGATGTGG + Intergenic
933605187 2:84375263-84375285 TTTAAATTCTTTAAGTATTGAGG - Intergenic
934084042 2:88494556-88494578 TTTAAGGACATGAAGAGATGTGG + Intergenic
934695195 2:96394988-96395010 TTTAATTTTTTGTAGAGATGGGG + Intergenic
934752718 2:96804072-96804094 TTTAACTTTTTGTAGAGATGGGG + Intronic
934784533 2:96995428-96995450 TTTAATTTTTTGTAGAGATGGGG - Intronic
934958527 2:98646532-98646554 TTTAATTTTTTGTAGAGATGAGG - Intronic
935027822 2:99294084-99294106 TGTAATTTTTTGAAGAGATGGGG + Intronic
935066797 2:99655836-99655858 TTGAGGTTATTGCAGTGATGTGG + Intronic
935240981 2:101178037-101178059 TTTAATTTTTTGTAGAGATGAGG - Intronic
935241766 2:101184919-101184941 TTAAAGTTTTTGTAGAGATGAGG + Intronic
935344960 2:102099351-102099373 TTTGAGTTCTTCCAGGGATGGGG + Intronic
936158618 2:110067153-110067175 TTTAATTTTTTGTAGAGATGGGG + Intergenic
936186042 2:110304170-110304192 TTTAATTTTTTGTAGAGATGGGG - Intergenic
937953616 2:127407180-127407202 TTTAATTTTTTGTAGAGATGGGG - Intergenic
938030885 2:127992142-127992164 TTTAATTTTTTGTAGAGATGGGG + Intronic
938751688 2:134337300-134337322 TTAAATTTTTTGTAGTGATGGGG - Intronic
939485151 2:142802009-142802031 TTTACTTTCCTGAAGTGATATGG - Intergenic
939492709 2:142895855-142895877 TTTAACTTTTTGTAGAGATGAGG + Intronic
939622313 2:144435425-144435447 TTTTATTTCTTGTAGAGATGGGG - Intronic
939735186 2:145835310-145835332 TTTAATTTCTTGTAGAGATGGGG + Intergenic
939758362 2:146141826-146141848 GTTAAGTTCTTGGAGTAAGGTGG + Intergenic
940242143 2:151574910-151574932 TTTATTTTCTTGCAGAGATGGGG + Intronic
940321582 2:152383149-152383171 TTTAATTTCTGGGAGAGATGCGG + Intronic
940737735 2:157472312-157472334 TTTTAGTTTTTGTAGAGATGGGG - Intronic
941117064 2:161484124-161484146 TTTGAGTTTTTGTAGAGATGGGG + Intronic
941297506 2:163758536-163758558 TTTAATTTTTGGAAGAGATGAGG - Intergenic
941451705 2:165667785-165667807 TGCAAGTTATTGAAGTGGTGGGG - Intronic
941976803 2:171414553-171414575 TTTAATTTTTTGTAGAGATGGGG - Intronic
942134575 2:172911937-172911959 TTTAATTTGTTGTAGAGATGAGG + Intronic
942193517 2:173494534-173494556 TTTAATTTTTTGTAGAGATGGGG + Intergenic
942238272 2:173934057-173934079 TTTAATTTTTTGTAATGATGGGG - Intronic
942308010 2:174627716-174627738 TTTAATTTTTTGTAGAGATGGGG + Intronic
942348284 2:175026375-175026397 TTAAAGTTTTTGTAGAGATGGGG - Intergenic
942359870 2:175160864-175160886 TTTAAATTTTTGTAGAGATGGGG - Intronic
942434397 2:175956105-175956127 TTTAACTTTTTGTAGAGATGGGG - Intronic
942652016 2:178179155-178179177 TTTAATTTTTTGTAGAGATGGGG - Intergenic
942657034 2:178224760-178224782 TTTAATTCCTTGTAGAGATGGGG - Intronic
943193687 2:184715571-184715593 TTTTAATTCTGGTAGTGATGAGG + Intronic
943206617 2:184906471-184906493 TTTATGTTTTTGTAGAGATGGGG + Intronic
943333602 2:186588721-186588743 TTTAAATTTTTGTAGAGATGAGG + Intergenic
943366121 2:186969113-186969135 TTTTAGTTTTTGTAGAGATGAGG - Intergenic
943822970 2:192351333-192351355 TTTAAGTTTTTGTAGAGATGGGG + Intergenic
944091248 2:195914446-195914468 TATAGGTTCTTCAAGTGATTGGG + Intronic
944141097 2:196458095-196458117 TTTAATTTTTTGTAGAGATGGGG - Intronic
944219315 2:197286547-197286569 TTTAATTTTTTGTAGAGATGGGG + Intronic
944417095 2:199489763-199489785 TTTAATTTTTTGTAGAGATGAGG + Intergenic
944427255 2:199596095-199596117 ATTAAGTTCTTGAAGTGGGGAGG + Intergenic
944638152 2:201694790-201694812 TTTAACTTCTTGTAGAGATGGGG + Intronic
944642306 2:201740151-201740173 TTTAATTTTTTGTAGAGATGGGG - Intronic
944658535 2:201900831-201900853 TTTAATTTCTTGTAGAGATGAGG - Intergenic
944725437 2:202466768-202466790 TTTAAGTGTTTGTAGAGATGTGG + Intronic
944784396 2:203053688-203053710 TTTAATTTTTTGTAGAGATGAGG + Intronic
945412765 2:209532064-209532086 TTTTAGTTTTTGTAGAGATGAGG - Intronic
945603399 2:211895427-211895449 TTTAAGTTTTTGAAGAGATGGGG + Intronic
945907733 2:215614000-215614022 TTTAATTTTTTGTAGAGATGGGG - Intergenic
945975854 2:216270246-216270268 TTTAAATTTTTGTAGAGATGAGG + Intronic
946018845 2:216625674-216625696 TTTAATTTTTTGTAGAGATGGGG + Intergenic
946439949 2:219686696-219686718 TTAAAGTTCTTAAAGTTCTGAGG - Intergenic
947225298 2:227834161-227834183 TTTAATTTTTTGTAGAGATGGGG + Intergenic
947288020 2:228539726-228539748 TTTAATTTTTTGCAGAGATGGGG + Intergenic
947560661 2:231147320-231147342 TTTAATTCTTTGTAGTGATGGGG - Intronic
947603911 2:231471427-231471449 TTTAATTTTTTGTAGAGATGGGG + Intronic
947862510 2:233370922-233370944 TTTAATTTTTTGTAGAGATGAGG + Intronic
947921352 2:233877495-233877517 TTTAAATTCTTTGAGTGAGGAGG - Intergenic
948047738 2:234956729-234956751 TTTAAATTCTTGTAGAAATGGGG + Intronic
948351648 2:237345798-237345820 TTTAAGTAGGTGAAGTGTTGGGG - Intronic
948934632 2:241155028-241155050 CTGATGTTCTGGAAGTGATGTGG + Intronic
1168762432 20:358373-358395 TTTAATTTTTTGTAGAGATGGGG - Intronic
1168827026 20:820757-820779 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1169032863 20:2425166-2425188 TTTAATTTTTTGTAGAGATGGGG - Intronic
1169043019 20:2511280-2511302 TTTAATTTTTTGTAGAGATGGGG + Intronic
1169134061 20:3185829-3185851 TTTAACTTTTTGTAGAGATGGGG - Intergenic
1169162373 20:3391993-3392015 TTTTAGTTTTTGTAGAGATGAGG - Intronic
1169346589 20:4833938-4833960 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1169370595 20:5026334-5026356 TTTTAGTTTTTGTAGAGATGAGG + Intergenic
1169385529 20:5145993-5146015 TTTAAATTTTTGTAGAGATGGGG + Intronic
1170020457 20:11831638-11831660 TTTAATTTTTTTAAGCGATGAGG + Intergenic
1170098790 20:12675787-12675809 TTTCAGTTTTTGTAGAGATGGGG - Intergenic
1170344788 20:15372877-15372899 TTTAATTTTTTGTAGAGATGGGG - Intronic
1171000408 20:21409312-21409334 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
1171025265 20:21624352-21624374 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1171458944 20:25287806-25287828 TTTAATTTTTTGTAGAGATGAGG - Intronic
1171956655 20:31468937-31468959 TTTAAATTTTTGTAGAGATGGGG - Intronic
1172069625 20:32247050-32247072 TTTAAATTTTTGTAGAGATGAGG + Intergenic
1172169854 20:32923009-32923031 TTTAATTTTTTGTAGAGATGAGG - Intronic
1172239887 20:33405930-33405952 TTTAATTTGTTGTAGAGATGGGG - Intergenic
1172248120 20:33460072-33460094 TTAAAGTTTTTGTAGAGATGAGG - Intergenic
1172405047 20:34681975-34681997 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1172455235 20:35066277-35066299 TTTAATTTTTAGTAGTGATGGGG + Intronic
1172575810 20:36007693-36007715 TTTAATTTATTGTAGAGATGAGG + Intronic
1172642939 20:36452349-36452371 TTAAATTTCTTGTAGAGATGGGG + Intronic
1172647596 20:36480831-36480853 TTTTAGTTTTTGTAGAGATGAGG - Intronic
1172648291 20:36485207-36485229 TTTAATTTTTTGTAGAGATGGGG - Intronic
1172683050 20:36731946-36731968 TTTAATTTTTTGTAGAGATGGGG - Intronic
1172728654 20:37068317-37068339 TTTAAATTTTTGTAGAGATGGGG - Intronic
1172837779 20:37884038-37884060 TTTAAATTTTTGTAGAGATGAGG - Intergenic
1172989387 20:39021652-39021674 TTTAATTTTTTGTAGAGATGGGG + Intronic
1173538117 20:43831277-43831299 TTTAATTTTTTGGAGAGATGGGG - Intergenic
1173674697 20:44823526-44823548 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1173782361 20:45766822-45766844 TTTCAGTTTTTGTAGAGATGGGG - Intronic
1173900233 20:46582299-46582321 TTTAATTTTTTGTAGAGATGGGG + Intronic
1174043523 20:47716821-47716843 TTTTAGTTTTTGTAGAGATGAGG - Intronic
1174233791 20:49070758-49070780 TTTTATTTTTTGTAGTGATGGGG - Intronic
1174416530 20:50371071-50371093 TTTAAATTTTTGTAGAGATGGGG - Intergenic
1175351011 20:58318038-58318060 TTTTATTTCTTGTAGAGATGAGG + Intronic
1175353147 20:58340643-58340665 TTTAAGTTCTTTGAGTGTAGGGG - Intronic
1175983108 20:62751047-62751069 TTTTAGTTTTTGTAGAGATGGGG + Intronic
1176610108 21:8873755-8873777 TTTAAGTTCCGGTAGTGATAGGG - Intergenic
1177023009 21:15886486-15886508 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1177154518 21:17487675-17487697 TTTAAGTTCTTTAAGCCATTTGG + Intergenic
1177662576 21:24105254-24105276 TTTAAGTTCTGGAATACATGTGG - Intergenic
1177698682 21:24608475-24608497 TTTTAGTTTTTGTAGAGATGGGG - Intergenic
1177934883 21:27332720-27332742 TTTTAGTTTTTGACGAGATGAGG - Intergenic
1178252305 21:31015765-31015787 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1178294568 21:31398223-31398245 TTCAAGTTAGTGAATTGATGTGG - Intronic
1178346354 21:31831810-31831832 TTGAATTTCTTGCAGTGCTGTGG + Intergenic
1178448708 21:32671135-32671157 TTTATTTTTTTGTAGTGATGGGG - Intronic
1178458976 21:32783836-32783858 TTTAATTTTTTATAGTGATGGGG - Intergenic
1178536871 21:33417260-33417282 TTTAATTTTTTGAAGAGATGGGG + Intronic
1178557851 21:33609481-33609503 TTTTATTTCTTGTAGAGATGGGG + Intronic
1178595947 21:33952454-33952476 TTTAATTTTTTGTAGCGATGGGG - Intergenic
1178754615 21:35336854-35336876 TTTAATTTCTTGGAGTAGTGAGG + Intronic
1178858178 21:36267509-36267531 TTAAATTTCTTGTAGAGATGGGG - Intronic
1179130280 21:38630162-38630184 TTAAAGTTCTGGAAATGATGTGG + Intronic
1179153291 21:38827931-38827953 TTAAATTTCTTGTAGAGATGGGG + Intergenic
1179210049 21:39316764-39316786 TTTTATTTCTTGTAGAGATGGGG - Intronic
1179223856 21:39434688-39434710 TTTTAGTTTTTGAAGAGATAGGG + Intronic
1179345769 21:40555807-40555829 TTTAATTTTTTGCAGCGATGGGG + Intronic
1179457572 21:41509448-41509470 TTTAATTTTTTGTAGAGATGGGG + Intronic
1179473699 21:41629866-41629888 TTTAAATTTTTGTAGAGATGAGG - Intergenic
1179772962 21:43637632-43637654 TTTAAGTTTTTGTAGAGATAGGG - Intronic
1180020656 21:45123771-45123793 TTTAATTTTTTGTAGAGATGGGG + Intronic
1180206180 21:46262473-46262495 TTTAATTTTTTGTAGAGATGGGG - Intronic
1180360170 22:11883008-11883030 TTTAAGTTCCAGTAGTGATAGGG - Intergenic
1180721948 22:17915916-17915938 TTTAATTTTTTGTAGAGATGAGG - Intronic
1180978063 22:19861803-19861825 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1181156918 22:20928279-20928301 TTTAATTTTTTGCAGAGATGGGG - Intronic
1181899015 22:26137125-26137147 TTAAATTTTTTGTAGTGATGGGG + Intergenic
1181957097 22:26595646-26595668 TTTAATTTTTTGTAGAGATGGGG + Intronic
1182020761 22:27079871-27079893 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1182102246 22:27666131-27666153 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1182473422 22:30562346-30562368 TTTAATTTTTTGTAGAGATGGGG + Intronic
1182592623 22:31393702-31393724 TTTAATTTTTTGCAGTGATACGG - Intergenic
1182607726 22:31519744-31519766 TTTAATTTTTTGTAGAGATGGGG + Intronic
1182646215 22:31811719-31811741 TTTAATTTTTTGTAGAGATGAGG + Intronic
1182716610 22:32361118-32361140 TTTAAATTATAGAAGTTATGAGG + Exonic
1182748420 22:32623366-32623388 TTTTATTTTTTGTAGTGATGGGG + Intronic
1183054631 22:35297206-35297228 TTTTAGTTTTTGTAGAGATGGGG - Intergenic
1183161977 22:36120493-36120515 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1183447382 22:37867197-37867219 TTTAATTTGTTGCAGAGATGGGG + Intronic
1183507408 22:38217009-38217031 TTAAATTTCTTGTAGAGATGGGG - Intergenic
1183662289 22:39228414-39228436 TTTAAGTTTTTGTAGAGATGAGG - Intronic
1183807218 22:40221607-40221629 TTTAATTTTTTGTAGAGATGGGG + Intronic
1183886644 22:40889195-40889217 TTTAGGTTTTTGTAGAGATGGGG + Intronic
1183963137 22:41424788-41424810 TTTAAGTTTTTGTAGAGATGGGG + Intergenic
1183964109 22:41431084-41431106 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1184066168 22:42122916-42122938 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1184132828 22:42527945-42527967 TTTATGTTTTTGTAGAGATGAGG + Intergenic
1184163575 22:42714107-42714129 TTTTATTTTTTGTAGTGATGTGG - Intronic
1184581292 22:45419559-45419581 TTTAATTTTTTGTAGAGATGAGG - Intronic
1184631978 22:45788819-45788841 TTTAATTTTTTGTAGAGATGAGG + Intronic
949199858 3:1363085-1363107 TTTTATTTTTTTAAGTGATGGGG - Intronic
949484748 3:4527346-4527368 TTTAAATTTTTGTAGAGATGGGG + Intronic
949522430 3:4868931-4868953 CTGAAGTTCCTGATGTGATGGGG - Intronic
949580991 3:5388103-5388125 TATAATTTCATTAAGTGATGAGG + Intergenic
949585827 3:5435889-5435911 TTTAATTTTTTGTAGAGATGGGG + Intergenic
950164381 3:10782796-10782818 TTTAATTTATTGTAGAGATGTGG - Intergenic
950291321 3:11786761-11786783 TTAAAGTTTTTGTAGAGATGCGG + Intergenic
950306909 3:11922603-11922625 TTTAATTTTTTGTAGAGATGGGG + Intergenic
950784588 3:15423558-15423580 TTTAAATTTTTGTAGAGATGAGG - Intronic
950803481 3:15575711-15575733 TTTAATTTTTTGTAGAGATGGGG + Intronic
950808206 3:15626602-15626624 TTTAATTTTTTGTAGAGATGGGG - Intronic
950814904 3:15690738-15690760 TTTTAATTTTTGTAGTGATGAGG + Intronic
951528127 3:23672918-23672940 TTTAATTTTTTGTAGAGATGGGG + Intergenic
951565313 3:24007153-24007175 TTTGAATTCTTGTAGAGATGAGG - Intergenic
951732124 3:25821805-25821827 TTTAAGTTTTTGTAGAGATGAGG - Intergenic
951884933 3:27515096-27515118 TTTAATTTTTTGTAGTGATGAGG - Intergenic
952047229 3:29337464-29337486 TTTAATTTTTTGTAGAGATGGGG - Intronic
952238426 3:31504921-31504943 TTTAAATTTTTGTAGAGATGAGG + Intergenic
952312452 3:32202305-32202327 TTTAATTTTTTGGAGAGATGAGG + Intergenic
952352794 3:32556712-32556734 TTTAATTTTTTGTAGAGATGGGG + Intronic
952360210 3:32623512-32623534 TTTAATTTTTTGTAGAGATGGGG - Intergenic
952372471 3:32736600-32736622 TTTTATTTCTTGTAGAGATGGGG - Intronic
952475532 3:33706078-33706100 TTTTATTTCTTGTAGAGATGGGG - Intronic
952732227 3:36650704-36650726 TTTAAGTTTTTGTAGAGATGAGG - Intergenic
953330317 3:42047375-42047397 TTTAACTTTTTGTAGAGATGGGG + Intronic
953340691 3:42131883-42131905 TTTAATTTTTTGTAGAGATGGGG - Intronic
953443970 3:42946600-42946622 TTTAATTTTTTGTAGAGATGGGG - Intronic
953603736 3:44393283-44393305 TTTAAGTTTTTGTAGAGATGGGG - Intronic
953633487 3:44640893-44640915 TTTAAGTTTATGAAAGGATGAGG - Intronic
953685283 3:45073296-45073318 TTTAATTTTTTGTAGAGATGGGG + Intergenic
953702114 3:45204678-45204700 TTTTATTTCTTGTAGAGATGGGG + Intergenic
953743409 3:45555659-45555681 TTTAAATTTTTGTAGAGATGGGG - Intronic
954087559 3:48257196-48257218 TTTGTGTTCTGGAAGAGATGGGG + Intronic
954174472 3:48833208-48833230 TTTAATTTTTTGAAAAGATGGGG + Intronic
954265344 3:49467083-49467105 TTTAATTTTTTGTAGAGATGGGG + Intergenic
954526285 3:51274602-51274624 TTTAATTTTTTGTAGAGATGAGG - Intronic
954717887 3:52535596-52535618 TTTAATTTTTTGTAGAGATGGGG - Intronic
954739653 3:52738277-52738299 TTAAATTTTTTGCAGTGATGGGG + Intronic
955223021 3:57038615-57038637 TTTAATTTTTTGTAGAGATGGGG + Intronic
955224396 3:57049195-57049217 TTTTAGTTTTTGTAGAGATGGGG - Intronic
955312643 3:57904892-57904914 TTTAATTTTTTGTAGAGATGGGG - Intronic
955683380 3:61525878-61525900 TTTAATTTTTTGTAGAGATGGGG + Intergenic
955775883 3:62432495-62432517 GTTAATGTCTTAAAGTGATGGGG + Intronic
955964406 3:64373510-64373532 TTTTATTTCTTGTAGAGATGAGG - Intronic
956022691 3:64949269-64949291 TTTAATTTTTTGTAGAGATGGGG - Intergenic
956360920 3:68446077-68446099 TTTAATTTTTTGTAGTGATGGGG + Intronic
956413692 3:69004889-69004911 TTTTAATTTTTGAAGAGATGGGG - Intronic
956432883 3:69205379-69205401 TTTAATTTCTTGTAGAGATGGGG + Intronic
956464451 3:69505195-69505217 TTTAATTTTTTGTAGAGATGGGG - Intronic
956592993 3:70935250-70935272 TTTAAGTTCTTAAAATCATCTGG + Intergenic
957418363 3:79935164-79935186 GTTTAGTTCTTTAAGTTATGAGG - Intergenic
957846698 3:85745691-85745713 TTTAATTTTTTGTAGAGATGGGG - Intronic
957979011 3:87483870-87483892 TTTAAATTTTTGTAGAGATGAGG + Intergenic
958096487 3:88952214-88952236 TTTATGTTTTTGAGGTGATCTGG + Intergenic
958713030 3:97741173-97741195 TTTAATTTTTTGTAGAGATGGGG - Intronic
959079974 3:101789861-101789883 TTTATGTTTTTGCAGAGATGGGG + Intronic
959251488 3:103953444-103953466 TTTATTTTTTTGAAGTAATGAGG - Intergenic
959287742 3:104438647-104438669 TTTAAATGCTTGAAGTGAAAGGG + Intergenic
959713854 3:109411530-109411552 TTTTATTTTTTGTAGTGATGGGG - Intergenic
960171065 3:114461476-114461498 TTTAAATTTTTGTAGTGATGAGG + Intronic
961028075 3:123578441-123578463 TTTAATTTTTTGTAGAGATGGGG + Intronic
961128404 3:124442810-124442832 TTTAATTTTTTGTAGAGATGGGG - Intronic
961259742 3:125592209-125592231 TTTAATTTTTTGTAGAGATGGGG + Intronic
961760804 3:129166085-129166107 TTTAATTTTTTGTAGAGATGAGG - Intergenic
961797049 3:129416821-129416843 TTTAATTTTTTGTAGAGATGGGG + Intronic
961840711 3:129709288-129709310 TTTAAGTTTTTGTAGAGATGGGG - Intronic
962602047 3:136999408-136999430 TTTATTTTTTTGTAGTGATGGGG + Intronic
962605469 3:137029262-137029284 TTTAATTTTTTGTAGAGATGAGG - Intergenic
962713959 3:138111225-138111247 CTTAGGGTCTTGAAGTAATGGGG + Intronic
962786362 3:138771742-138771764 TTTAAATTTTTGTAGAGATGGGG - Intronic
963077389 3:141359756-141359778 TTTAACTTTTTGTAGAGATGAGG - Intronic
963183881 3:142391554-142391576 TTTAATTTTTTGTAGAGATGGGG - Intronic
963738951 3:149055550-149055572 TTTAGTTTTTTTAAGTGATGAGG - Intronic
963806426 3:149727558-149727580 TTTAACTTTTTGTAGAGATGAGG - Intronic
963810738 3:149773984-149774006 TTTCAGTTTTTGTAGAGATGGGG - Intronic
963866379 3:150366495-150366517 TTTAATTTTTTGTAGAGATGGGG + Intergenic
964154744 3:153571241-153571263 TTTAAGTTCTAGAATGCATGTGG - Intergenic
964594761 3:158412778-158412800 TTAAAGTTTTTGTAGAGATGGGG - Intronic
964782555 3:160356691-160356713 TTTAAATTTTTGTAGAGATGGGG + Intronic
965492854 3:169361172-169361194 TTTATGTTCTTGTAGTGCGGTGG - Intronic
965682899 3:171270208-171270230 TTTAAGTTCCTTAAGGGCTGGGG + Intronic
966381064 3:179345981-179346003 TTTATGTTCTTGAACAGATTTGG + Intergenic
966391562 3:179458205-179458227 TTTTAGTTCTTAATGTGATGTGG + Intergenic
966637044 3:182147249-182147271 TATAACTTCTAGAAGTGATATGG - Intergenic
967222308 3:187257555-187257577 TTGAAGTTTTTGTAGAGATGGGG + Intronic
967803642 3:193692928-193692950 TTTAATTTTTTGTAGAGATGGGG + Intronic
968344622 3:197991276-197991298 TTTATTTTTTTGTAGTGATGAGG + Intronic
1202736791 3_GL000221v1_random:8542-8564 TTTAAGTTCCGGTAGTGATAGGG - Intergenic
968428660 4:539991-540013 TTGAAGTTTTTGGAGAGATGAGG - Intronic
968672879 4:1861791-1861813 TTTAAATTTTTGTAGAGATGAGG + Intergenic
968803741 4:2759224-2759246 TTTAACTTTTTGTAGAGATGGGG - Intergenic
969056515 4:4406007-4406029 TTCAAGTCCTTGAAGAGATGGGG - Intronic
970847022 4:20552527-20552549 TTTAAGTCCTTGATGTGACAGGG - Intronic
971174074 4:24263920-24263942 TTTATGTTTTTGTAGTGATGGGG + Intergenic
971275627 4:25193904-25193926 TTCAATTTTTTGTAGTGATGGGG - Intronic
971289875 4:25327650-25327672 TTTTACTTTTTGAAGAGATGAGG + Intronic
971325679 4:25641797-25641819 TTTAATTTCTTGAAATGTTAAGG - Intergenic
971412780 4:26393017-26393039 TTTAATTTTTAGAAGAGATGGGG + Intronic
971714873 4:30163066-30163088 TTTAAGTTTTTGTAGAGATGAGG - Intergenic
971767127 4:30846949-30846971 TTTAATTTCTTGTAGAAATGAGG - Intronic
971770460 4:30889006-30889028 TTTAATTTGTTGTAGGGATGAGG - Intronic
971947648 4:33301764-33301786 TTTAAGTTTTTGTAGAGATGGGG + Intergenic
972039269 4:34570929-34570951 TTTAAATTTTTGAAGAAATGGGG - Intergenic
972214226 4:36876812-36876834 TTTAATTTTTTGTAGAGATGGGG + Intergenic
972435899 4:39035192-39035214 TTTAAATTTTTGTAGAGATGGGG + Intergenic
972586943 4:40446563-40446585 TTTAAATTTTTGTAGAGATGGGG - Intronic
972592086 4:40497444-40497466 TTTAATTTTTTGAAGAGAAGGGG - Intronic
972683796 4:41332268-41332290 TTTAAGTTTTTGTAGAGACGGGG - Intergenic
972728919 4:41773730-41773752 TTTAATTTTTTGTAGAGATGGGG - Intergenic
973162855 4:47040260-47040282 TTTAGGTTCTTGCAGCTATGTGG + Intronic
973249930 4:48050048-48050070 TTTAACATTTTGAAGTGATCTGG - Intergenic
973311823 4:48717712-48717734 TTTAATTTTTTGTAGAGATGGGG + Intronic
973385287 4:49509379-49509401 TTTAAGTTCCGGTAGTGATAGGG + Intergenic
973768989 4:54189626-54189648 TTTAATTTTTTGTAGAGATGAGG - Intronic
973833568 4:54786711-54786733 TTTAATTTTTTGAAGAGACGGGG + Intergenic
973912952 4:55602264-55602286 TTTGAATTCTTGAAGAAATGAGG - Intronic
974472935 4:62341288-62341310 TTTAACTTTTTGAAGAGATGGGG - Intergenic
974743354 4:66037267-66037289 TTTAATTTTTTTAAGAGATGGGG - Intergenic
975130026 4:70823695-70823717 TTTAATTTTTTGTAGAGATGGGG - Intronic
975636371 4:76453450-76453472 TTTCATTTTTTGTAGTGATGGGG + Intronic
976240728 4:82953775-82953797 TTTCAGTTTTTGTAGAGATGGGG - Intronic
976271151 4:83231504-83231526 TTTTAGTTTTTGTAGAGATGGGG - Intergenic
976301706 4:83521721-83521743 TTTAAATTTTTGTAGAGATGGGG + Intronic
976599273 4:86923261-86923283 TTTAATTTTTTGTAGAGATGGGG + Intronic
976858815 4:89637884-89637906 TTAAAGTTTTTGAAGAGATAGGG + Intergenic
978076501 4:104537336-104537358 TTTAAGTTCTGGTAGTCATATGG - Intergenic
978581117 4:110232332-110232354 TTTAAATTTTTGTAGAGATGGGG - Intergenic
978615795 4:110593853-110593875 TTTAATTTTTTGCAGAGATGAGG - Intergenic
978728011 4:111993111-111993133 TTTAAGTTCCTCATGTGATCCGG - Intergenic
979476864 4:121168690-121168712 TTTAAATTTTTGTAGAGATGTGG + Intronic
979793946 4:124820358-124820380 TTTCAGTTATTGGAGAGATGTGG - Intergenic
979984986 4:127302765-127302787 TTTATGTTCCAGAAGTGCTGAGG - Intergenic
980024005 4:127743306-127743328 TTTAATTTTTTGTAGAGATGCGG + Intronic
980177361 4:129363316-129363338 TTTTATGTCTTGAAGTCATGAGG + Intergenic
980469285 4:133230434-133230456 TTTAATTTTTTGTAGAGATGGGG - Intergenic
980618182 4:135261748-135261770 TTGAAGTTTTTGTAGAGATGCGG - Intergenic
980879972 4:138700164-138700186 TTTAAATTTTTGTAGAGATGGGG + Intergenic
981360672 4:143842165-143842187 TTTAATTTTTTGTAGAGATGGGG - Intergenic
981371431 4:143963223-143963245 TTTAATTTTTTGTAGAGATGGGG - Intergenic
981380516 4:144066429-144066451 TTTAATTTTTTGTAGAGATGGGG - Intergenic
981924541 4:150123866-150123888 TTTAATTTTTTGTAGAGATGAGG - Intronic
981957323 4:150493909-150493931 TTTAATTTTTTGTAGAGATGAGG - Intronic
981965299 4:150592803-150592825 TTTAACTTTTTGTAGAGATGAGG + Intronic
981974814 4:150713106-150713128 TTTAAATTTTTGAAGAGATGGGG + Intronic
981982561 4:150811675-150811697 TTTAATTTCTTGTAGAGATAAGG + Intronic
981984120 4:150832946-150832968 TTTAATTTCTTGAAGAGACAGGG + Intronic
982051553 4:151507294-151507316 TTAAATTTTTTGTAGTGATGGGG + Intronic
982566202 4:156990078-156990100 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
982660858 4:158205106-158205128 TTTAATTTTTTGTAGAGATGAGG - Intronic
982708784 4:158738752-158738774 TTTAATTTTTTGCAGAGATGGGG + Intergenic
982818425 4:159916375-159916397 TTTAAATTCTTGAGGTGATTTGG - Intergenic
983038848 4:162900593-162900615 TTTAAGTTTTTTAAGAGATTTGG + Intergenic
983136395 4:164087896-164087918 CTGAAATTATTGAAGTGATGCGG - Intronic
983141846 4:164159546-164159568 TTTAAGTGTTGGAAATGATGAGG + Intronic
983196653 4:164814154-164814176 TTTAAGTTTCTTAAGTGATTAGG - Intergenic
983333423 4:166360493-166360515 TTAAATTTTTTGTAGTGATGGGG + Intergenic
983419785 4:167502458-167502480 TTTAAGTTCTTTACATGCTGTGG + Intergenic
983567170 4:169165507-169165529 TTTTAGTTTTTTAAGAGATGGGG - Intronic
983607145 4:169600360-169600382 TTTAAATTTTTGTAGAGATGGGG + Intronic
983668038 4:170204496-170204518 TTTAATTTTTTGTAGTGATTGGG - Intergenic
983858552 4:172675609-172675631 TTTCAGTTTGTGAAATGATGAGG - Intronic
983858717 4:172677749-172677771 TTTAATTTTTTGTAGAGATGGGG - Intronic
984093964 4:175411158-175411180 TTTAATTTTTTGTAGAGATGGGG + Intergenic
984115594 4:175676572-175676594 TTTAAATTTTTGTAGAGATGGGG - Intronic
984119578 4:175725463-175725485 TTTAATTTTTTGTAGAGATGAGG + Intronic
984305487 4:177984089-177984111 TTGATATTCTTTAAGTGATGAGG + Intronic
984372354 4:178883794-178883816 TTTTAGTTTTTGTAGTGATGGGG + Intergenic
984760868 4:183361635-183361657 TTTAATTTCTTCAATTAATGAGG + Intergenic
984819721 4:183870741-183870763 TTTCAGTTGTTGCACTGATGGGG + Intronic
984842858 4:184083848-184083870 TTTAAATTTCTGAAGTGATTTGG + Intergenic
985020647 4:185685693-185685715 TTTAACTTTTTGTAGAGATGTGG + Intronic
985116645 4:186598696-186598718 TTTAAGTTTTTGTAGAGATGGGG + Intronic
1202769147 4_GL000008v2_random:184724-184746 TTTAAGTTCCGGTAGTGATAGGG + Intergenic
986798685 5:11237505-11237527 TTTAACTTTTTTAAGAGATGGGG + Intronic
986885093 5:12225190-12225212 TTTAACTGCTTGAAGGGATTTGG + Intergenic
988465817 5:31490604-31490626 CTTAAGGTCTTGAATTGAAGTGG - Intronic
989037576 5:37191658-37191680 TTTTAGTTTTTGTAGAGATGGGG - Intronic
989557278 5:42812295-42812317 TTTTGCTTCTTGCAGTGATGAGG + Intronic
990130613 5:52578310-52578332 TCTAAGTTGTTGAATTTATGAGG + Intergenic
990250924 5:53914311-53914333 CTTAAGTTGTTGAAGTGAGAGGG - Intronic
990425029 5:55678831-55678853 TTTAATTTTTTGTAGAGATGAGG + Intronic
990436691 5:55799545-55799567 TTTTAGTTTTTGTAGAGATGGGG + Intronic
990448673 5:55916206-55916228 TTTAATTTTTTGTAGAGATGGGG - Intronic
990758100 5:59098523-59098545 TTTAATTTTTTGTAGAGATGAGG - Intronic
991006567 5:61833504-61833526 TTCAAATTCCTTAAGTGATGAGG + Intergenic
991061551 5:62381734-62381756 TTTAATTTTTTGTAGAGATGGGG + Intronic
991226449 5:64278786-64278808 TTTAAATTTTTGTAGAGATGGGG + Intronic
991260708 5:64664611-64664633 TTGAAGTTCTTGGGGTGATGTGG + Intergenic
991356373 5:65773309-65773331 TTTTAGTTGTTGTAGAGATGAGG + Intronic
991661179 5:68952205-68952227 TTTATTTTTTTGTAGTGATGAGG + Intergenic
992085127 5:73271311-73271333 TTTAATTTTTTGTAGGGATGAGG - Intergenic
992113121 5:73514763-73514785 TTTAACTTTTTGTAGAGATGGGG - Intergenic
992119255 5:73574148-73574170 TTTAATTTTTTGTAGAGATGGGG - Intronic
992325304 5:75654506-75654528 TTTAAATTTTTGTAGAGATGGGG - Intronic
992463200 5:76982229-76982251 TTTAAATTTTTGTAGAGATGGGG - Intergenic
992734347 5:79703917-79703939 TTTAATTTTTTGTAGAGATGGGG - Intronic
993323349 5:86503451-86503473 TTTAATTTTTTGTAGAGATGGGG + Intergenic
993327048 5:86553431-86553453 TTTAATTTTTTGTAGAGATGAGG - Intergenic
993477779 5:88386385-88386407 ATTATATTCTTGAAGTAATGTGG - Intergenic
993929244 5:93917703-93917725 TTTAATTTTTTGTAGAGATGAGG - Intronic
994092298 5:95820178-95820200 TTTAAGTTTTTGTACAGATGGGG - Intronic
994121925 5:96124185-96124207 TTTATCTTCTTTCAGTGATGGGG + Intergenic
994276902 5:97849548-97849570 TTTAATCTCGTGAAGTTATGGGG + Intergenic
994573591 5:101546311-101546333 TTTAATTTTTTGTAGAGATGAGG + Intergenic
994677566 5:102844493-102844515 TTTAATTTTTTGTAGAGATGGGG - Intronic
994680250 5:102877854-102877876 TTTAAATTTTTGTAGAGATGGGG - Intronic
994830325 5:104773838-104773860 TTGAAGTTCTGAAAGTGCTGAGG + Intergenic
995377999 5:111499506-111499528 TTTAATTTTTTGTAGAGATGTGG - Exonic
995637956 5:114217332-114217354 TTTAAAGTCTTGAAGTTAGGTGG - Intergenic
996187408 5:120494346-120494368 TTTATTTTTTTGTAGTGATGGGG + Intronic
996193074 5:120569368-120569390 CTTTAGTTTTTGCAGTGATGGGG + Intronic
996839231 5:127828258-127828280 TTAAATTTCTTGAAATGATTGGG - Intergenic
997000925 5:129761224-129761246 TTGAAGTTTTTCATGTGATGGGG - Intronic
997334039 5:133091852-133091874 TTTAACTTTTTGTAGAGATGAGG - Intronic
997483118 5:134204632-134204654 TTTAACTTTTTGTAGAGATGGGG + Intronic
997576287 5:134980152-134980174 TTTAATTTTTTGTAGAGATGGGG + Intronic
997771071 5:136554834-136554856 TCTAAGTTTTGGAAGAGATGTGG - Intergenic
998013553 5:138714614-138714636 TTTAATTTTTTGAAGAGATGGGG + Intronic
998113624 5:139520455-139520477 TATAAGTTCTTGACCAGATGTGG + Intergenic
998464679 5:142333976-142333998 TTTAATTTTTTGTAGAGATGGGG - Intergenic
998465279 5:142338805-142338827 TTTAATTTTTTGTAGAGATGGGG - Intergenic
998600094 5:143576408-143576430 TTTAATTTTTTGTAGAGATGAGG - Intergenic
998662460 5:144254934-144254956 TTTAAATTTTTGTAGGGATGGGG + Intronic
998940373 5:147275494-147275516 TTTAATTTTTTGTAGAGATGGGG + Intronic
998943912 5:147316681-147316703 TTTAATTTTTTGTAGAGATGGGG - Intronic
999128349 5:149263747-149263769 TTTAATTTTTTGTAGAGATGAGG + Intergenic
999335899 5:150716210-150716232 TTTAATTTCTTAAGGGGATGGGG + Intronic
999534819 5:152504724-152504746 TTTAAATTTTTGTAGCGATGAGG + Intergenic
999971315 5:156866706-156866728 TTTAAGTTCTTGAAGGGAAAAGG + Intergenic
1000235416 5:159354902-159354924 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1000489079 5:161886601-161886623 TTTAATTTTTTGTAGAGATGGGG - Intronic
1000839915 5:166205293-166205315 ATTAAGTTCTTAAAGTAATGTGG + Intergenic
1000972174 5:167726629-167726651 TTTTATTTTTTGTAGTGATGGGG + Intronic
1001497304 5:172198334-172198356 TTTAATTTTTTGTAGAGATGGGG - Intronic
1001764614 5:174235579-174235601 TTTAAGTTCTTGAAGTGATGGGG - Intronic
1002057670 5:176608089-176608111 TTTAAATTTTTGTAGAGATGGGG + Intronic
1002134674 5:177100306-177100328 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
1002436903 5:179237080-179237102 TTTTAGTTTTTGTAGTGATGAGG - Intronic
1002498350 5:179631437-179631459 TTTAACTTTTTGTAGAGATGGGG - Intronic
1002624827 5:180518669-180518691 TTTTAGTTTTTGTAGAGATGAGG + Intronic
1003151445 6:3554705-3554727 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1003274133 6:4634204-4634226 TTAAAGTTTTTGTAGAGATGGGG - Intergenic
1003385118 6:5660472-5660494 TTTAATTTTTTGTAGAGATGGGG - Intronic
1003576042 6:7296113-7296135 TTGAAGTTCTTAAATTGAGGTGG - Intronic
1003625954 6:7741467-7741489 TTTAATTTTTTGTAGAGATGGGG + Intronic
1003625973 6:7741603-7741625 TTTAATTTTTTGTAGAGATGGGG + Intronic
1003657504 6:8026730-8026752 AGAAAGTTGTTGAAGTGATGTGG - Intronic
1003820880 6:9895610-9895632 TTTAAGTTTCTGTAGTGTTGTGG + Intronic
1003928412 6:10899374-10899396 TTTTATTTCTTGTAGAGATGGGG - Intronic
1004165346 6:13251881-13251903 TTTAAATTTTTGTAGAGATGGGG - Intronic
1004383685 6:15153916-15153938 TTTAAGTTTTAGTAGAGATGGGG - Intergenic
1004431615 6:15549987-15550009 AGGAAGTTCTTGAAGTGAGGTGG - Intronic
1004467794 6:15902090-15902112 TTTTAGTTCTTGGAGAAATGGGG - Intergenic
1004626778 6:17384513-17384535 TTTTAATTTTTGTAGTGATGAGG - Intergenic
1004713224 6:18192087-18192109 TTTAATTTTTTGTAGAGATGGGG - Intronic
1004826505 6:19427134-19427156 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1004973138 6:20934670-20934692 TTTCAGTTTTTGTAGAGATGGGG - Intronic
1004991104 6:21139678-21139700 TTTAATTTTTTGTAGAGATGGGG + Intronic
1005081130 6:21957683-21957705 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1005149609 6:22733933-22733955 TTTAAGTACTTGATATGATTTGG + Intergenic
1005301720 6:24477544-24477566 TTTAAATTTTTGTAGAGATGTGG - Intronic
1005409390 6:25526723-25526745 TTTAATTTTTTGTAGGGATGAGG + Intronic
1005751052 6:28883182-28883204 TTTAATTTTTTGTAGAGATGTGG + Intergenic
1005952170 6:30639960-30639982 TTTAACTTTTTGTAGAGATGGGG - Intronic
1005961150 6:30694231-30694253 TTTTATTTTTTGTAGTGATGGGG + Intergenic
1006178435 6:32138287-32138309 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1006262891 6:32891646-32891668 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1006310718 6:33257205-33257227 TTTAATTTTTTGTAGAGATGAGG + Intronic
1006350553 6:33518002-33518024 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1006607863 6:35271915-35271937 TTTAAATTTTTGTAGAGATGAGG - Intronic
1006734111 6:36260118-36260140 TTTAATTTTTTGTAGAGATGGGG - Intronic
1006770928 6:36551905-36551927 TTAAATTTTTTGAAGAGATGGGG + Intergenic
1007206692 6:40158355-40158377 TTTAATTCCTTCAAGTCATGAGG + Intergenic
1007248600 6:40480447-40480469 TTTAAATTTTTGTAGAGATGGGG + Intronic
1007555513 6:42762565-42762587 TGTAAGTTCCTGGAGGGATGTGG + Intronic
1007980748 6:46154760-46154782 TTTAAGTTGTTGAATTTATGAGG + Intergenic
1008378352 6:50816956-50816978 TTTTAGTTCTAGAAGTCAGGGGG + Intergenic
1008601416 6:53099566-53099588 TTTAATTTTTAGAAGAGATGAGG - Exonic
1008709170 6:54202718-54202740 TTTAATTTGTTGTAGAGATGGGG - Intronic
1008744739 6:54656304-54656326 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
1009168463 6:60369067-60369089 TTTAAGTTCATGAGGGGATAGGG - Intergenic
1009852106 6:69210564-69210586 TTTAATTTTTTGTAGAGATGGGG + Intronic
1009985128 6:70772670-70772692 TTTAAATTCTTGAAGTTGTCTGG - Intronic
1010227448 6:73504301-73504323 TTTAAGTTTTTGTAGATATGGGG + Intronic
1010701507 6:79053876-79053898 TTTAGGTTATAGATGTGATGAGG - Intronic
1010702852 6:79072658-79072680 TTTTAGTTTTTGTAGAGATGGGG + Intronic
1010744775 6:79548039-79548061 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1010880526 6:81163915-81163937 TTTAAATTTTTGCAGAGATGGGG - Intergenic
1011061827 6:83278628-83278650 TTTAATTTCTTGTAGATATGAGG + Intronic
1011637875 6:89391210-89391232 TTAAAGTTTTTGTAGAGATGGGG - Intronic
1011752551 6:90468045-90468067 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1011795051 6:90943827-90943849 TTTCAGTTTTTGTAGAGATGGGG + Intergenic
1012411770 6:98966812-98966834 TTTATTTTCTTGTAGAGATGGGG + Intergenic
1012910556 6:105113102-105113124 TTTAATTTTTTGTAGAGATGGGG + Intronic
1013468343 6:110437336-110437358 TTTAAGTTGGTGAAGAGTTGGGG - Intronic
1013517218 6:110899466-110899488 TTTAAAGTCTTGAAGTCAAGTGG + Intergenic
1013521763 6:110939974-110939996 TTTAATTTTTTGTAGCGATGGGG + Intergenic
1013548708 6:111186069-111186091 TTTAATTTTTTGTAGAGATGGGG + Intronic
1013551584 6:111212618-111212640 TTTAATTTTTTGTAGAGATGAGG - Intronic
1013736868 6:113238195-113238217 TTTAAGTTTTTGTAGAGATAGGG - Intergenic
1013994634 6:116294193-116294215 TTTAATTTTTTGTAGAGATGAGG + Intronic
1014245073 6:119059148-119059170 TTTAATTTTTTGTAGAGATGAGG + Intronic
1014474843 6:121859673-121859695 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1015495732 6:133881302-133881324 TTAAATTTCTTGTAGAGATGAGG - Intergenic
1015516328 6:134086137-134086159 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1015583577 6:134752997-134753019 TCTTAGTTCTTGAAGGCATGAGG - Intergenic
1015832384 6:137384534-137384556 TTTTATTTTTTGTAGTGATGAGG + Intergenic
1015983974 6:138867500-138867522 TTTAACTTTTTGTAGAGATGGGG - Intronic
1016105572 6:140158110-140158132 TTTTAGTTTTTGTAGAGATGAGG + Intergenic
1016607695 6:145951336-145951358 TTTTAGTTTTAGAAGTTATGAGG - Intronic
1016738127 6:147502367-147502389 TTCAACTTCTTGAAGCAATGGGG - Intergenic
1016980502 6:149849582-149849604 TTTAACTTTTTGTAGAGATGAGG - Intronic
1017264618 6:152428129-152428151 TAGCAGTTCTTAAAGTGATGGGG - Intronic
1017865231 6:158437387-158437409 TTTAATTTTTTGTAGAGATGGGG - Intronic
1017890031 6:158630322-158630344 TTTAAATTTTTGGAGAGATGGGG - Intronic
1017905487 6:158755168-158755190 TTTAATTTCTTGTAGAGATGGGG - Intronic
1017925919 6:158911768-158911790 TGGAAGTTCTAGAAGTCATGTGG + Intergenic
1018051748 6:160015433-160015455 CTTGAGTTCTTGCTGTGATGCGG + Intronic
1018056122 6:160053886-160053908 TTAAATTTTTTGAAGAGATGGGG + Intronic
1018485165 6:164233743-164233765 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
1018646896 6:165957306-165957328 TTTAAATTTTTGTAGAGATGGGG - Intronic
1019144509 6:169968034-169968056 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1019389970 7:780998-781020 TGTAAGTGTTTGAAGTGACGGGG - Intronic
1019464191 7:1177575-1177597 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
1019512978 7:1427358-1427380 TTTAACTTCTTGTAGAGATGGGG - Intergenic
1019652488 7:2167711-2167733 TTTAATTTTTTTAAGAGATGAGG - Intronic
1019769485 7:2874724-2874746 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1019970734 7:4538734-4538756 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1019973229 7:4559083-4559105 TTTAAATTTTTGTAGAGATGGGG - Intergenic
1019973645 7:4562658-4562680 TTTAATTTTTTGCAGAGATGGGG + Intergenic
1020036097 7:4963920-4963942 TTTAATTTGTTGTAGAGATGGGG - Intergenic
1020098239 7:5380271-5380293 TTTATGTTTTTGTAGAGATGGGG - Intronic
1020233652 7:6339294-6339316 TTTAATTTTTTGTAGAGATGGGG - Intronic
1020527095 7:9275651-9275673 TTTCTTTTCTTGGAGTGATGAGG - Intergenic
1020535577 7:9391965-9391987 TTTATTTTTTTGAAGAGATGAGG - Intergenic
1020710982 7:11604766-11604788 ATTAATTTCTTGACTTGATGTGG + Intronic
1020811676 7:12856495-12856517 TTTAATTTTTTGCAGAGATGGGG + Intergenic
1020975506 7:15001121-15001143 TTCAAGTTCTACAAGTGATTAGG + Intergenic
1022155424 7:27657059-27657081 TTAAAGTTCTGGAAATGCTGTGG + Intronic
1022329509 7:29363998-29364020 TTTAATTTTTTTAAGAGATGGGG - Intronic
1022404400 7:30073813-30073835 TTTAATTTTTTGTAGAGATGAGG - Intronic
1022463110 7:30630680-30630702 TTTTAGTTTTTGTAGAGATGGGG + Intronic
1022887276 7:34659458-34659480 TGTATGTTCTTGAAATGATTTGG + Intronic
1022920063 7:35004035-35004057 TTATGGTTCTTGAAGTGATGGGG - Intronic
1022933114 7:35143004-35143026 TTTAATTTTTTGTAGCGATGAGG - Intergenic
1023562900 7:41494407-41494429 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1023877939 7:44300206-44300228 TTTAATTTTTTGTAGAGATGGGG + Intronic
1024038108 7:45525879-45525901 TTTTATTTTTTGAAGAGATGAGG + Intergenic
1024077093 7:45826935-45826957 TTTAATATTTTGAAGAGATGGGG - Intergenic
1025127325 7:56354485-56354507 TTTAATATTTTGAAGAGATGGGG + Intergenic
1025296400 7:57778355-57778377 TTTGTGTTTTTGAAGAGATGAGG - Intergenic
1026060586 7:67022083-67022105 TTTAATTTTTTGTAGAGATGAGG + Intronic
1026061099 7:67027024-67027046 TTTTATTTCTTGTAGAGATGGGG - Intronic
1026065327 7:67066674-67066696 TTTAATTTTTTGTAGAGATGAGG - Intronic
1026175720 7:67995120-67995142 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1026293466 7:69029605-69029627 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1026545015 7:71314727-71314749 TTTAATTTCTTGTAGAGATAGGG - Intronic
1026640138 7:72117138-72117160 TTTAATTTTTTGTAGAGATGGGG - Intronic
1026711546 7:72745194-72745216 TTTAATTTTTTGTAGAGATGAGG + Intronic
1026717264 7:72800369-72800391 TTTTATTTCTTGTAGAGATGGGG + Intronic
1026765840 7:73159040-73159062 TTAAATTTCTTGTAGCGATGGGG + Intergenic
1026810844 7:73463410-73463432 TTTAATTTTTTGTAGGGATGGGG + Intronic
1026893689 7:73998015-73998037 TTTAACTTTTTGTAGGGATGGGG - Intergenic
1026920995 7:74155313-74155335 TTAAAGTTTTTGGAGAGATGGGG + Intergenic
1027042314 7:74968737-74968759 TTAAATTTCTTGTAGCGATGGGG + Intronic
1027081328 7:75233621-75233643 TTAAATTTCTTGTAGCGATGGGG - Intergenic
1027128952 7:75577156-75577178 TTTAATTTTTTGTAGAGATGGGG - Intronic
1027130586 7:75587789-75587811 TTTAATTTTTTGTAGAGATGGGG - Intronic
1027136125 7:75625209-75625231 TTTAAGTTTTTATAGAGATGGGG + Intronic
1027437601 7:78181181-78181203 TTTAAGTTCTTGCATTAATAAGG - Intronic
1027765282 7:82332825-82332847 TTTAATTTTTTGTAGAGATGAGG - Intronic
1027769404 7:82387907-82387929 TTTAATTTTTTGTAGAGATGGGG - Intronic
1028015197 7:85701238-85701260 TTTAAATCCTTAAAGTGAGGAGG + Intergenic
1028134982 7:87215963-87215985 TTTAATTTGTTGTAGAGATGGGG - Intronic
1028314299 7:89381195-89381217 TGTAATATCTTGAAGTTATGTGG + Intergenic
1028338546 7:89689019-89689041 TTTAATTTCTTGAGTTGCTGTGG + Intergenic
1028539822 7:91930211-91930233 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1028707456 7:93866653-93866675 TTTAATTTTTTGTAGAGATGGGG + Intronic
1028947327 7:96595338-96595360 TTTAAGTTTTTGTAGAGATGGGG - Intronic
1029007463 7:97225667-97225689 TTAAAGTTTTTGTAGAGATGAGG - Intergenic
1029014093 7:97296196-97296218 TTTAACTTTTTGTAGAGATGGGG + Intergenic
1029116083 7:98237942-98237964 TTTAAATTTTTGTAGAGATGGGG + Intronic
1029277285 7:99414310-99414332 TTTAATTTTTAGTAGTGATGGGG + Intronic
1029373753 7:100165991-100166013 TTTAATTTTTTGTAGAGATGGGG - Intronic
1029389913 7:100268221-100268243 TTAAATTTCTTGTAGCGATGGGG - Intronic
1029531887 7:101130843-101130865 TTAAATTTTTTGAAGAGATGAGG - Intronic
1029540050 7:101177521-101177543 TTTAATTTTTTGTAGAGATGGGG + Intronic
1029547991 7:101221394-101221416 TTTAATTTTTTGTAGAGATGGGG + Intronic
1029557584 7:101281068-101281090 TTTAATATTTTGAAGAGATGGGG + Intergenic
1029829032 7:103235770-103235792 TTTAATTTTTTGTAGGGATGAGG - Intergenic
1030043369 7:105472416-105472438 TTTAATTTATTGTAGAGATGGGG + Intronic
1030168537 7:106578944-106578966 TTTAAATTTTTGTAGAGATGGGG - Intergenic
1030243591 7:107357839-107357861 TTTTAGTTTTTGTAGAGATGTGG + Intronic
1030269290 7:107653066-107653088 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1030290692 7:107869595-107869617 TTTAAGTTTTTGTAGAGATTAGG + Intergenic
1030616599 7:111743989-111744011 TTTAGGTTTTTGTAGAGATGGGG + Intronic
1030827095 7:114171398-114171420 TTTAATTTTTTGCAGAGATGAGG - Intronic
1030834109 7:114262249-114262271 TTTAATTTTTTGTAGAGATGGGG - Intronic
1030895786 7:115058349-115058371 TTAAATTTTTTGTAGTGATGGGG - Intergenic
1030928292 7:115485559-115485581 GTTAAGTTCCAGAAATGATGTGG + Intergenic
1031042554 7:116854181-116854203 TTTAAATTTTTGTAGAGATGAGG - Intronic
1031452698 7:121941349-121941371 TTTGTGTTGTTTAAGTGATGTGG + Intronic
1031818958 7:126474439-126474461 TTTAATTTTTTGTAGAGATGAGG + Intronic
1032044647 7:128594777-128594799 TATAAATTGTTGAAGTCATGTGG + Intergenic
1032242499 7:130175287-130175309 TTTAATTTTTTGTAGAGATGGGG - Intronic
1032261430 7:130340509-130340531 TTTAACTTTTTGTAGAGATGGGG + Intergenic
1032264023 7:130358169-130358191 TTTAATTTTTTGTAGAGATGGGG + Intronic
1032341888 7:131081568-131081590 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1032349092 7:131143651-131143673 TTTAAATTTTTGTAGAGATGGGG - Intronic
1032638013 7:133732440-133732462 TTTAAGTTCTGGGATTCATGTGG - Intronic
1032827067 7:135581369-135581391 TTTAATTTTTTGAAGAGATGAGG - Intronic
1033073268 7:138224154-138224176 TTTAAATTTTTGTAGAGATGAGG - Intergenic
1033326625 7:140384537-140384559 TTTTAGTTTTTGTAGAGATGGGG - Intronic
1033432255 7:141299954-141299976 TTTAATTTCTTGTAAAGATGGGG + Intronic
1034310473 7:150083392-150083414 TTTGAGTTTTTGTAGAGATGGGG - Intergenic
1034373547 7:150623921-150623943 TTTTAGTTTTTGTAGAGATGGGG - Intergenic
1034530274 7:151692012-151692034 TTTAATTTTTTGTAGAGATGGGG - Intronic
1034616963 7:152426406-152426428 TTTAATTTTTTGTAGAGATGGGG + Intronic
1034673931 7:152878101-152878123 TTTAAATTTTTGTAGGGATGAGG - Intergenic
1034796367 7:154017238-154017260 TTTGAGTTTTTGTAGAGATGGGG + Intronic
1035137315 7:156716963-156716985 TTTAATTTTTTGTAGAGATGGGG - Intronic
1035152771 7:156888744-156888766 TTTAATTTTTTGTAGAGATGGGG - Intronic
1035306363 7:157935543-157935565 TTTACGTTCTTGAACAGATCTGG + Intronic
1035753110 8:2009406-2009428 TTTTAGTTCTGGTAGCGATGGGG + Intergenic
1035978431 8:4339849-4339871 TTTAAGTTTTTGTAGAGATGAGG - Intronic
1036292934 8:7510945-7510967 TTTAAATTTTTGTAGAGATGGGG - Intergenic
1036329627 8:7810063-7810085 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1036464441 8:8983296-8983318 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1036490884 8:9224446-9224468 TTTTATTTTTTGAAGAGATGGGG - Intergenic
1036581609 8:10080709-10080731 TTTAATTTCTAGTAGAGATGAGG + Intronic
1036727206 8:11230818-11230840 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1037010343 8:13834603-13834625 TTTTAGCTCTTGGAGTGAAGTGG + Intergenic
1037227453 8:16610121-16610143 TTTAATTTTTTGTAGTGATGGGG - Intergenic
1037431968 8:18823115-18823137 TTCTAGTTATTGAAGTGATAAGG - Intronic
1037449235 8:19000216-19000238 TTTAACTTTTTGTAGGGATGGGG - Intronic
1037484753 8:19336690-19336712 TTTAATTTTTTGTAGAGATGGGG - Intronic
1037918332 8:22786453-22786475 TTTTAGTTTTTGAAGAGACGGGG + Intronic
1038005377 8:23425294-23425316 TTCAAGTGCTGGCAGTGATGCGG - Intronic
1038174929 8:25173136-25173158 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1038523868 8:28256879-28256901 TTTAATTTCTTAAGGTGATCTGG + Intergenic
1038545781 8:28424745-28424767 TTTAATTTTTTGTAGAGATGGGG - Intronic
1038565179 8:28613995-28614017 TTTATGTTTTTGTAGAGATGGGG + Intronic
1038740172 8:30210367-30210389 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1038794405 8:30697106-30697128 TTTATGTTTTTGTAGAGATGGGG - Intronic
1038794644 8:30699111-30699133 TTTAAATTTTTGTAGAGATGGGG - Intronic
1039248919 8:35639896-35639918 TTAAATTTTTTGTAGTGATGAGG + Intronic
1039437343 8:37569034-37569056 TTTTAGTTTTTGTAGAGATGGGG - Intergenic
1039485449 8:37906256-37906278 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1039558470 8:38494301-38494323 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1039593977 8:38774670-38774692 TTTTTGTTTTTGAAGGGATGGGG + Intronic
1039818169 8:41113140-41113162 TTTAATTTTTTGTAGAGATGAGG - Intergenic
1040001551 8:42581209-42581231 TTTAATTTTTTGAAGAGATAGGG - Intergenic
1040042223 8:42927775-42927797 TTTAAATTTTTGTAGGGATGAGG + Intronic
1040420352 8:47233908-47233930 TGTATGTTTTTGAAGAGATGAGG - Intergenic
1040572399 8:48622461-48622483 TTTAAGTTTTAGTAGAGATGGGG + Intergenic
1040884948 8:52251512-52251534 TTTAAATCATTGAAGTGATTGGG + Intronic
1040991625 8:53357475-53357497 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1041067012 8:54091913-54091935 TTAAAGTTTTTGTAGAGATGAGG - Intronic
1041166153 8:55095011-55095033 TTTAATTTTTTGTAGAGATGAGG - Intergenic
1041261836 8:56027230-56027252 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1041308525 8:56489482-56489504 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1041580501 8:59454136-59454158 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1042256027 8:66804905-66804927 TTTAAATTTTTGTAGAGATGAGG - Intronic
1042262979 8:66879081-66879103 TTTAATTTTTTGTAGAGATGGGG - Intronic
1042279841 8:67044217-67044239 TTTAAATTTTTGCAGAGATGGGG + Intronic
1042305059 8:67322522-67322544 TTTAACTTTTTGTAGTGATGGGG - Intronic
1042427630 8:68666827-68666849 TTAAAGTTTTTCAAATGATGTGG + Intronic
1042437003 8:68777496-68777518 TTTAAGTACTTTAAGTGAAAAGG - Intronic
1042532458 8:69830363-69830385 TTTAATTTTTTTAAGAGATGGGG + Intronic
1043507959 8:80921494-80921516 TTTAATTTTTTGGAGAGATGGGG - Intergenic
1043607580 8:82021318-82021340 TTTAATTTCTTGTAGAGATGGGG - Intergenic
1043704890 8:83335815-83335837 TTTAATTTTTTGGAGAGATGGGG + Intergenic
1043865174 8:85366183-85366205 TTTAAGTTTTTGTAGAGATGAGG + Intronic
1044526185 8:93254033-93254055 ATTAAGTTCTTGAAGAAATAAGG + Intergenic
1044563171 8:93633608-93633630 TCTAAGTTCTAGAAAAGATGAGG + Intergenic
1044997130 8:97848089-97848111 TTTTAGTTTTAGTAGTGATGGGG - Intronic
1045047979 8:98296876-98296898 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1045214984 8:100139418-100139440 TTTTAGTTTTTGTAGAGATGGGG - Intronic
1045274349 8:100688862-100688884 TTTTATTTTTTGAAGAGATGAGG - Intronic
1045347675 8:101309022-101309044 TTTTATTTTTTGAAGAGATGAGG + Intergenic
1045464225 8:102454407-102454429 TTTAAGGTTTTGTAGAGATGGGG - Intergenic
1045604479 8:103756596-103756618 TTTAATTTTTTGTAGAGATGGGG + Intronic
1046196742 8:110873877-110873899 TTTAAATTTTTTAAGAGATGGGG + Intergenic
1046717283 8:117581560-117581582 ATTAATTACTTGAGGTGATGTGG + Intergenic
1046725146 8:117665858-117665880 TTTTAGTTTTTGTAGAGATGGGG - Intergenic
1046859028 8:119069420-119069442 TTTAATTTTTTGTAGAGATGGGG - Intronic
1046919852 8:119716685-119716707 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1047315777 8:123731700-123731722 TTTAATTTTTTGTAGAGATGGGG - Intronic
1047456641 8:125019410-125019432 TTTAATTTTTTGTAGAGATGGGG - Intronic
1047685089 8:127296845-127296867 TTAAAGTTTTTGGAGAGATGGGG + Intergenic
1047831520 8:128636050-128636072 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1047942172 8:129836710-129836732 TTTTATTTTTTGTAGTGATGGGG - Intergenic
1047984619 8:130219959-130219981 TTTAATTTTTTGTAGAGATGGGG + Intronic
1048158963 8:131993722-131993744 TTTAACTTTTTGCAGAGATGGGG - Intronic
1048167154 8:132073149-132073171 TTTTATTTCTTGTAGAGATGGGG + Intronic
1048209243 8:132441147-132441169 TTTGAGGTCTTCAAGTGTTGGGG - Intronic
1048550077 8:135425977-135425999 TTAAATTTTTTGAAGAGATGGGG - Intergenic
1049052710 8:140211218-140211240 TTTAATTTGTTGTAGAGATGTGG - Intronic
1049078023 8:140415794-140415816 TTTAAATTTTTGTAGAGATGGGG - Intronic
1049644737 8:143731086-143731108 TTTTATTTTTTGTAGTGATGTGG - Intronic
1049808039 8:144550098-144550120 TTTATGTTTTTGTAGAGATGAGG - Intronic
1050005498 9:1125311-1125333 TTTAATTTCAAGATGTGATGGGG - Intergenic
1050308520 9:4329798-4329820 TGTCATTTCTTCAAGTGATGAGG + Intronic
1050347710 9:4709086-4709108 TTTCAGTTCTTAAATTGGTGTGG + Intergenic
1050438541 9:5635150-5635172 GTTAATTTTTTGAAGAGATGTGG + Intronic
1050824316 9:9926001-9926023 TTTAAGTTTTTGTAGAAATGGGG + Intronic
1050889525 9:10806585-10806607 TTTAATTTTTTGTAGAGATGAGG - Intergenic
1050911116 9:11072486-11072508 TTTTTGTTCTTTAAGTGATGTGG + Intergenic
1051162688 9:14226374-14226396 TTTTAGTTTTTGTAGAGATGGGG - Intronic
1051186349 9:14465204-14465226 TTTACATTTTTGAAGGGATGAGG - Intergenic
1051323255 9:15934214-15934236 TTTTAGTTTTTGTAGAGATGAGG - Intronic
1051386250 9:16512157-16512179 TTTCTTTCCTTGAAGTGATGAGG + Intronic
1051425875 9:16930971-16930993 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1051932470 9:22402816-22402838 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1051997463 9:23234975-23234997 TTTAATTTTTTGAAGAGACGAGG - Intergenic
1052161234 9:25262447-25262469 TCACAGTTGTTGAAGTGATGTGG + Intergenic
1052370910 9:27663494-27663516 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1053204235 9:36172904-36172926 TTAAATTTTTTGTAGTGATGTGG + Intergenic
1053298236 9:36930397-36930419 TTTAATTTTTTGTAGAGATGGGG + Intronic
1053325372 9:37141911-37141933 TTTAAGTCCTTGAAGTGCTATGG + Intronic
1053403951 9:37854280-37854302 TTTAAATTTTTGTAGAGATGGGG + Intronic
1054801405 9:69352962-69352984 TTTAAGTTTTTGTAGAGATGGGG - Intronic
1054935718 9:70685576-70685598 TTTAACTTTTTGTAGAGATGGGG + Intronic
1055193288 9:73554032-73554054 TTTAAGTTAGTGAAGAAATGTGG - Intergenic
1055302582 9:74897641-74897663 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1055309890 9:74967670-74967692 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1055366403 9:75549036-75549058 TTTAAATTTTTGTAGAGATGAGG + Intergenic
1055419254 9:76120215-76120237 TTTAAGTTGTTGCATTTATGAGG + Intronic
1055782976 9:79840358-79840380 TTTAAGTTTTTAATGTGCTGTGG + Intergenic
1055914234 9:81384285-81384307 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1056120560 9:83483684-83483706 TCTAATTTTTTGTAGTGATGGGG - Intronic
1056159147 9:83871086-83871108 TTTAATTTTTTGTAGAGATGGGG + Intronic
1056165699 9:83938918-83938940 TTTAAATTTTTGTAGAGATGGGG + Exonic
1056225842 9:84494214-84494236 TTTAATTTTTAGTAGTGATGAGG - Intergenic
1056615829 9:88164580-88164602 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1056644091 9:88395618-88395640 TTTAATTTTTTGTAGAGATGAGG + Intronic
1056775604 9:89510241-89510263 TTTAAATTTTTGTAGAGATGGGG + Intergenic
1057330210 9:94107124-94107146 TTTAATTTTTTGTAGAGATGAGG + Intronic
1057374130 9:94503243-94503265 GTTTATTTTTTGAAGTGATGAGG + Intergenic
1057620059 9:96626804-96626826 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1058024562 9:100127021-100127043 TTTAATTTTTTGTAGAGATGGGG - Intronic
1058372470 9:104285702-104285724 TTGAAGTTTTTGTAGAGATGGGG - Intergenic
1058633441 9:107012924-107012946 TTTAATTTTTTTAAGGGATGGGG + Exonic
1058711791 9:107685354-107685376 TCTAAGCTCTTGCAGAGATGTGG + Intergenic
1058966493 9:110043889-110043911 TTTAATTTTTTGTAGAGATGGGG + Intronic
1059063211 9:111054989-111055011 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1059083415 9:111274199-111274221 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1059170743 9:112122330-112122352 TTTAATTTTTTGTAGAGATGGGG + Intronic
1059227776 9:112688646-112688668 TTTAATTTTTTGTAGAGATGGGG - Intronic
1059625490 9:116060353-116060375 ATTAAGTAATTGTAGTGATGTGG - Intergenic
1059965672 9:119611074-119611096 TTCAAGTTCTTGAAAGGAGGAGG + Intergenic
1060364111 9:122991776-122991798 TTTAAGTTTTTCTAGAGATGGGG + Intronic
1060492592 9:124095814-124095836 TTTATTTTCTTGTAGAGATGGGG + Intergenic
1060998461 9:127888195-127888217 TTTAATTTTTTGTAGAGATGAGG - Intronic
1061074914 9:128335239-128335261 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1061198519 9:129122273-129122295 TTTAATTTTTTGTAGAGATGGGG + Intronic
1061241565 9:129377201-129377223 TTAAAGATCTTGAAATGAGGAGG + Intergenic
1061330844 9:129891287-129891309 TTTAATTTTTTGTAGAGATGAGG - Intronic
1061462211 9:130749204-130749226 ATTGAGTTCTTGTAGTTATGAGG + Intronic
1061523048 9:131133100-131133122 TTTCAGTTCTGGATGTGCTGTGG + Exonic
1061581970 9:131543522-131543544 TTTAACTTTTTGTAGAGATGTGG + Intergenic
1061776173 9:132966184-132966206 TTTTATTTCTTGTAGAGATGGGG - Intronic
1061916627 9:133758892-133758914 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1062006036 9:134239001-134239023 TTTTATTTCTTGTAGAGATGGGG - Intergenic
1062079375 9:134613839-134613861 TTGAATTTCTTAAAGTGATTTGG - Intergenic
1062405445 9:136394088-136394110 TTTTACTTTTTGAAGAGATGGGG + Intronic
1203694027 Un_GL000214v1:78439-78461 TTTAAGTTCCAGTAGTGATAGGG + Intergenic
1203705519 Un_KI270742v1:38986-39008 TTTAAGTTCCGGTAGTGATAGGG - Intergenic
1203558479 Un_KI270744v1:26819-26841 TTTAAGTTCCAGTAGTGATAGGG + Intergenic
1203642246 Un_KI270751v1:25624-25646 TTTAAGTTCCAGTAGTGATAGGG - Intergenic
1185841363 X:3394671-3394693 TTTTAGTTTTTGTAGAGATGAGG - Intergenic
1185911654 X:3986599-3986621 TTTAATTTTTTGTAGGGATGGGG - Intergenic
1185969900 X:4650885-4650907 TTTAAGTTTTTGTAGAGATGAGG + Intergenic
1186016461 X:5200355-5200377 TTTTAGTTTTTGTAGAGATGGGG + Intergenic
1186028285 X:5338206-5338228 TTTAACTTTTTGTAGAGATGGGG - Intergenic
1186170754 X:6873947-6873969 TTTAATTTTTTGTAGAGATGAGG - Intergenic
1186318289 X:8395176-8395198 TTTAACTTTTTGTAGAGATGGGG - Intergenic
1186549421 X:10487030-10487052 TTTTATTTTTTGTAGTGATGGGG + Intronic
1186578340 X:10790319-10790341 TTTAATTTTTTGTAGAGATGGGG + Intronic
1186657827 X:11634175-11634197 TTTAATTTTTTGTAGAGATGGGG + Intronic
1187134653 X:16535263-16535285 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1187160254 X:16758215-16758237 TTTAATTTTTTGTAGAGATGGGG + Intronic
1187289694 X:17941324-17941346 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1187381023 X:18802241-18802263 TTTAAGTTTTTGTAGAGATGGGG + Intronic
1187432292 X:19236249-19236271 TTTAACTTTTTGTAGAGATGGGG + Intergenic
1187874069 X:23789195-23789217 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1187882626 X:23860965-23860987 TTTAATTTTTTGTAGAGATGTGG - Intronic
1188010843 X:25054435-25054457 TTTTATTTTTTGTAGTGATGGGG + Intergenic
1188491530 X:30743107-30743129 TTTAATTTTTTGTAGAGATGAGG - Intergenic
1188511483 X:30941112-30941134 TTTAAATTTTTGTAGAGATGAGG + Intronic
1188547775 X:31328620-31328642 CTTAAGATCATGAAGTGATAGGG - Intronic
1189094658 X:38125490-38125512 TTTGAATTCTGGAAGTGGTGAGG + Exonic
1189162778 X:38827543-38827565 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1189344537 X:40230883-40230905 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1189388987 X:40560162-40560184 TTTTATTTCTTGTAGAGATGGGG + Intergenic
1189503201 X:41583915-41583937 TTTAATTTTTTGTAGAGATGGGG + Intronic
1189768239 X:44394216-44394238 TTAAAGTTTTTGTAGAGATGGGG - Intergenic
1189938463 X:46095119-46095141 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1189946055 X:46180180-46180202 TTTAAGTTTCTCAAGTGGTGGGG + Intergenic
1190020434 X:46869238-46869260 TTTAATTTTTTTAAGAGATGGGG - Intronic
1190041193 X:47073719-47073741 TTTAATTTTTTGTAGAGATGAGG - Intergenic
1190077640 X:47329516-47329538 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1190104523 X:47549854-47549876 TTTGATTTCTTGTAGAGATGGGG + Intergenic
1190229159 X:48568421-48568443 TTTTTTTTCTTGTAGTGATGGGG - Intergenic
1190468924 X:50755974-50755996 TTTAAGTTGTTAAAGTGCAGTGG - Intronic
1190486895 X:50935894-50935916 TTTAATTTTTGGAAGAGATGGGG + Intergenic
1190856023 X:54295857-54295879 TTTAATTTTTTGTAGAGATGGGG + Intronic
1191632977 X:63343666-63343688 TGTATGTTATTGAAGTTATGTGG + Intergenic
1191868073 X:65721908-65721930 TTTAAGTTTTTGTAGAGATGGGG - Intronic
1191907782 X:66112456-66112478 TTTAATTTTTTGTAGGGATGGGG - Intergenic
1192058339 X:67796706-67796728 TATTAGTTTTTGAAGAGATGGGG - Intergenic
1192427548 X:71090731-71090753 TTTTATTTTTTGTAGTGATGGGG + Intergenic
1192500476 X:71646997-71647019 TTAAATTTTTTGTAGTGATGGGG + Intergenic
1192540618 X:71968168-71968190 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1192569695 X:72192767-72192789 TTAAAGTTTTTGTAGAGATGGGG + Intronic
1192577714 X:72256021-72256043 TCCAAGTTCTTGTAGTGAAGTGG + Intronic
1193109971 X:77718970-77718992 TTTAATTTTTTGTAGAGATGGGG + Intronic
1194006436 X:88499351-88499373 TTTTAATTTTTGAAGAGATGGGG + Intergenic
1194143478 X:90234661-90234683 TTTAAATTTTTGTAGAGATGAGG + Intergenic
1194473772 X:94333629-94333651 TTTAAGTCATTGAATTGATGTGG + Intergenic
1194694021 X:97022879-97022901 TTAAAGTTTTTGTAGAGATGGGG - Intronic
1194825568 X:98558743-98558765 TTAAATTTTTTGAAGAGATGGGG + Intergenic
1195265674 X:103177242-103177264 TTTAAATTTTTGTAGAGATGGGG - Intergenic
1195699646 X:107693899-107693921 TTTATTTTCTTGTAGAGATGGGG + Intergenic
1195930775 X:110073206-110073228 TTTTAGTTTTTGTAGAGATGGGG + Intronic
1196161524 X:112489391-112489413 TTTATCTTCTTTAACTGATGTGG - Intergenic
1196319309 X:114269440-114269462 TTTAAGTTTTTGTAGAGTTGGGG + Intergenic
1196431590 X:115632906-115632928 TTTAACTTTTTGCAGAGATGGGG + Intronic
1196903003 X:120404178-120404200 TTTAATTTTTTGTAGAGATGAGG - Intergenic
1196909615 X:120472435-120472457 TTTAATTTTTTGTAGAGATGGGG - Intergenic
1196912039 X:120493603-120493625 TTTAATTTTCTGTAGTGATGGGG - Intergenic
1198091069 X:133330768-133330790 TTTAAATTTTTGTAGAGATGGGG - Intronic
1198113113 X:133520361-133520383 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1198202677 X:134437480-134437502 TTTAATTTTTTGTAGAGATGAGG - Intergenic
1198411799 X:136377363-136377385 TTTAATTTTTTGTAGAGATGGGG + Intronic
1198455490 X:136813373-136813395 TTTAATTTTTTGTAGAGATGAGG + Intergenic
1199411156 X:147524961-147524983 TTTAATTTTTTGTAGAGATGGGG + Intergenic
1199611254 X:149616620-149616642 TTAAAGATCTTGAGATGATGGGG - Intronic
1199821851 X:151457206-151457228 TTCTATTTCTTGTAGTGATGGGG - Intergenic
1201694811 Y:16812931-16812953 TTTAAGTTTTTGTAGAGATGGGG + Intergenic
1201895440 Y:18987413-18987435 TTTAATTTTTTGTAGGGATGGGG + Intergenic
1202047386 Y:20748601-20748623 TTTAAGTTTTTGCAGAGATAGGG - Intergenic
1202580151 Y:26371928-26371950 TTTAATTTTTTGTAGAGATGAGG - Intergenic