ID: 1001769626

View in Genome Browser
Species Human (GRCh38)
Location 5:174283476-174283498
Sequence CTGGAGCCAGAAGGGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001769618_1001769626 6 Left 1001769618 5:174283447-174283469 CCACACCTGAGGCTGTATTGCCA No data
Right 1001769626 5:174283476-174283498 CTGGAGCCAGAAGGGGAGAATGG No data
1001769616_1001769626 13 Left 1001769616 5:174283440-174283462 CCGCCTTCCACACCTGAGGCTGT No data
Right 1001769626 5:174283476-174283498 CTGGAGCCAGAAGGGGAGAATGG No data
1001769619_1001769626 1 Left 1001769619 5:174283452-174283474 CCTGAGGCTGTATTGCCACACCA No data
Right 1001769626 5:174283476-174283498 CTGGAGCCAGAAGGGGAGAATGG No data
1001769617_1001769626 10 Left 1001769617 5:174283443-174283465 CCTTCCACACCTGAGGCTGTATT No data
Right 1001769626 5:174283476-174283498 CTGGAGCCAGAAGGGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001769626 Original CRISPR CTGGAGCCAGAAGGGGAGAA TGG Intergenic
No off target data available for this crispr