ID: 1001770746

View in Genome Browser
Species Human (GRCh38)
Location 5:174294075-174294097
Sequence GCCTCCCTTTTCCACCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001770746_1001770750 24 Left 1001770746 5:174294075-174294097 CCTTCAAGGTGGAAAAGGGAGGC No data
Right 1001770750 5:174294122-174294144 GTGTTATGTGATGCGATGTGAGG No data
1001770746_1001770749 2 Left 1001770746 5:174294075-174294097 CCTTCAAGGTGGAAAAGGGAGGC No data
Right 1001770749 5:174294100-174294122 AAGAGGAGTTGGTGTAAGAGTGG No data
1001770746_1001770748 -9 Left 1001770746 5:174294075-174294097 CCTTCAAGGTGGAAAAGGGAGGC No data
Right 1001770748 5:174294089-174294111 AAGGGAGGCAGAAGAGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001770746 Original CRISPR GCCTCCCTTTTCCACCTTGA AGG (reversed) Intergenic
No off target data available for this crispr