ID: 1001771025

View in Genome Browser
Species Human (GRCh38)
Location 5:174295878-174295900
Sequence CCAGAGATGGAGACAAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001771021_1001771025 11 Left 1001771021 5:174295844-174295866 CCAGGGAAAAAGAACTCGTAATA No data
Right 1001771025 5:174295878-174295900 CCAGAGATGGAGACAAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001771025 Original CRISPR CCAGAGATGGAGACAAAGGA TGG Intergenic
No off target data available for this crispr