ID: 1001771440

View in Genome Browser
Species Human (GRCh38)
Location 5:174300075-174300097
Sequence CTAAATAAAGGGATGGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001771434_1001771440 -3 Left 1001771434 5:174300055-174300077 CCTGGAAGGAGCAGCCAGCACTA No data
Right 1001771440 5:174300075-174300097 CTAAATAAAGGGATGGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001771440 Original CRISPR CTAAATAAAGGGATGGCCAA GGG Intergenic
No off target data available for this crispr