ID: 1001771617

View in Genome Browser
Species Human (GRCh38)
Location 5:174301339-174301361
Sequence TGTGGTCTCCTGAGCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001771617_1001771622 -10 Left 1001771617 5:174301339-174301361 CCTCCAGAGCTCAGGAGACCACA No data
Right 1001771622 5:174301352-174301374 GGAGACCACAGGGAAAGGCCTGG No data
1001771617_1001771629 23 Left 1001771617 5:174301339-174301361 CCTCCAGAGCTCAGGAGACCACA No data
Right 1001771629 5:174301385-174301407 AGAGATAAGGAGAGATAAGGAGG No data
1001771617_1001771624 -4 Left 1001771617 5:174301339-174301361 CCTCCAGAGCTCAGGAGACCACA No data
Right 1001771624 5:174301358-174301380 CACAGGGAAAGGCCTGGATGAGG No data
1001771617_1001771630 29 Left 1001771617 5:174301339-174301361 CCTCCAGAGCTCAGGAGACCACA No data
Right 1001771630 5:174301391-174301413 AAGGAGAGATAAGGAGGACCAGG No data
1001771617_1001771631 30 Left 1001771617 5:174301339-174301361 CCTCCAGAGCTCAGGAGACCACA No data
Right 1001771631 5:174301392-174301414 AGGAGAGATAAGGAGGACCAGGG No data
1001771617_1001771627 10 Left 1001771617 5:174301339-174301361 CCTCCAGAGCTCAGGAGACCACA No data
Right 1001771627 5:174301372-174301394 TGGATGAGGCAGGAGAGATAAGG No data
1001771617_1001771625 0 Left 1001771617 5:174301339-174301361 CCTCCAGAGCTCAGGAGACCACA No data
Right 1001771625 5:174301362-174301384 GGGAAAGGCCTGGATGAGGCAGG No data
1001771617_1001771628 20 Left 1001771617 5:174301339-174301361 CCTCCAGAGCTCAGGAGACCACA No data
Right 1001771628 5:174301382-174301404 AGGAGAGATAAGGAGAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001771617 Original CRISPR TGTGGTCTCCTGAGCTCTGG AGG (reversed) Intergenic
No off target data available for this crispr