ID: 1001773327

View in Genome Browser
Species Human (GRCh38)
Location 5:174311670-174311692
Sequence CAGCCCGGTGTAGCCAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001773315_1001773327 28 Left 1001773315 5:174311619-174311641 CCGTGGGCTGGTGGAGAAAGATC No data
Right 1001773327 5:174311670-174311692 CAGCCCGGTGTAGCCAGCATGGG No data
1001773317_1001773327 6 Left 1001773317 5:174311641-174311663 CCGTAAACTAAACGGACCTTCCC No data
Right 1001773327 5:174311670-174311692 CAGCCCGGTGTAGCCAGCATGGG No data
1001773319_1001773327 -10 Left 1001773319 5:174311657-174311679 CCTTCCCAGCCCCCAGCCCGGTG No data
Right 1001773327 5:174311670-174311692 CAGCCCGGTGTAGCCAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001773327 Original CRISPR CAGCCCGGTGTAGCCAGCAT GGG Intergenic
No off target data available for this crispr