ID: 1001774021

View in Genome Browser
Species Human (GRCh38)
Location 5:174315343-174315365
Sequence CACCTTCTGTTTCCTGTACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001774021_1001774022 -9 Left 1001774021 5:174315343-174315365 CCGGGTACAGGAAACAGAAGGTG No data
Right 1001774022 5:174315357-174315379 CAGAAGGTGCAGAGTCTCCGAGG No data
1001774021_1001774023 -4 Left 1001774021 5:174315343-174315365 CCGGGTACAGGAAACAGAAGGTG No data
Right 1001774023 5:174315362-174315384 GGTGCAGAGTCTCCGAGGCGTGG No data
1001774021_1001774029 27 Left 1001774021 5:174315343-174315365 CCGGGTACAGGAAACAGAAGGTG No data
Right 1001774029 5:174315393-174315415 CAGGTGGTGAGGTCTTTGTAGGG No data
1001774021_1001774028 26 Left 1001774021 5:174315343-174315365 CCGGGTACAGGAAACAGAAGGTG No data
Right 1001774028 5:174315392-174315414 GCAGGTGGTGAGGTCTTTGTAGG No data
1001774021_1001774025 8 Left 1001774021 5:174315343-174315365 CCGGGTACAGGAAACAGAAGGTG No data
Right 1001774025 5:174315374-174315396 CCGAGGCGTGGATAAGAAGCAGG No data
1001774021_1001774027 16 Left 1001774021 5:174315343-174315365 CCGGGTACAGGAAACAGAAGGTG No data
Right 1001774027 5:174315382-174315404 TGGATAAGAAGCAGGTGGTGAGG No data
1001774021_1001774026 11 Left 1001774021 5:174315343-174315365 CCGGGTACAGGAAACAGAAGGTG No data
Right 1001774026 5:174315377-174315399 AGGCGTGGATAAGAAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001774021 Original CRISPR CACCTTCTGTTTCCTGTACC CGG (reversed) Intergenic
No off target data available for this crispr