ID: 1001774023

View in Genome Browser
Species Human (GRCh38)
Location 5:174315362-174315384
Sequence GGTGCAGAGTCTCCGAGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001774021_1001774023 -4 Left 1001774021 5:174315343-174315365 CCGGGTACAGGAAACAGAAGGTG No data
Right 1001774023 5:174315362-174315384 GGTGCAGAGTCTCCGAGGCGTGG No data
1001774016_1001774023 21 Left 1001774016 5:174315318-174315340 CCTGTGGCTGTGTGGGAAGGGTG No data
Right 1001774023 5:174315362-174315384 GGTGCAGAGTCTCCGAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001774023 Original CRISPR GGTGCAGAGTCTCCGAGGCG TGG Intergenic
No off target data available for this crispr