ID: 1001774024

View in Genome Browser
Species Human (GRCh38)
Location 5:174315374-174315396
Sequence CCTGCTTCTTATCCACGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001774024_1001774030 1 Left 1001774024 5:174315374-174315396 CCGAGGCGTGGATAAGAAGCAGG No data
Right 1001774030 5:174315398-174315420 GGTGAGGTCTTTGTAGGGCCAGG No data
1001774024_1001774032 7 Left 1001774024 5:174315374-174315396 CCGAGGCGTGGATAAGAAGCAGG No data
Right 1001774032 5:174315404-174315426 GTCTTTGTAGGGCCAGGTGAGGG No data
1001774024_1001774033 13 Left 1001774024 5:174315374-174315396 CCGAGGCGTGGATAAGAAGCAGG No data
Right 1001774033 5:174315410-174315432 GTAGGGCCAGGTGAGGGCTTTGG No data
1001774024_1001774031 6 Left 1001774024 5:174315374-174315396 CCGAGGCGTGGATAAGAAGCAGG No data
Right 1001774031 5:174315403-174315425 GGTCTTTGTAGGGCCAGGTGAGG No data
1001774024_1001774029 -4 Left 1001774024 5:174315374-174315396 CCGAGGCGTGGATAAGAAGCAGG No data
Right 1001774029 5:174315393-174315415 CAGGTGGTGAGGTCTTTGTAGGG No data
1001774024_1001774028 -5 Left 1001774024 5:174315374-174315396 CCGAGGCGTGGATAAGAAGCAGG No data
Right 1001774028 5:174315392-174315414 GCAGGTGGTGAGGTCTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001774024 Original CRISPR CCTGCTTCTTATCCACGCCT CGG (reversed) Intergenic
No off target data available for this crispr