ID: 1001774025

View in Genome Browser
Species Human (GRCh38)
Location 5:174315374-174315396
Sequence CCGAGGCGTGGATAAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001774021_1001774025 8 Left 1001774021 5:174315343-174315365 CCGGGTACAGGAAACAGAAGGTG No data
Right 1001774025 5:174315374-174315396 CCGAGGCGTGGATAAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001774025 Original CRISPR CCGAGGCGTGGATAAGAAGC AGG Intergenic
No off target data available for this crispr