ID: 1001774026

View in Genome Browser
Species Human (GRCh38)
Location 5:174315377-174315399
Sequence AGGCGTGGATAAGAAGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001774021_1001774026 11 Left 1001774021 5:174315343-174315365 CCGGGTACAGGAAACAGAAGGTG No data
Right 1001774026 5:174315377-174315399 AGGCGTGGATAAGAAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001774026 Original CRISPR AGGCGTGGATAAGAAGCAGG TGG Intergenic
No off target data available for this crispr