ID: 1001774028

View in Genome Browser
Species Human (GRCh38)
Location 5:174315392-174315414
Sequence GCAGGTGGTGAGGTCTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001774024_1001774028 -5 Left 1001774024 5:174315374-174315396 CCGAGGCGTGGATAAGAAGCAGG No data
Right 1001774028 5:174315392-174315414 GCAGGTGGTGAGGTCTTTGTAGG No data
1001774021_1001774028 26 Left 1001774021 5:174315343-174315365 CCGGGTACAGGAAACAGAAGGTG No data
Right 1001774028 5:174315392-174315414 GCAGGTGGTGAGGTCTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001774028 Original CRISPR GCAGGTGGTGAGGTCTTTGT AGG Intergenic
No off target data available for this crispr