ID: 1001777118

View in Genome Browser
Species Human (GRCh38)
Location 5:174337299-174337321
Sequence CACTTGGCGCAAATCTACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001777118_1001777124 7 Left 1001777118 5:174337299-174337321 CCCAAGTAGATTTGCGCCAAGTG No data
Right 1001777124 5:174337329-174337351 AGATGTGGCAGAGAGAACTTGGG No data
1001777118_1001777125 8 Left 1001777118 5:174337299-174337321 CCCAAGTAGATTTGCGCCAAGTG No data
Right 1001777125 5:174337330-174337352 GATGTGGCAGAGAGAACTTGGGG No data
1001777118_1001777126 9 Left 1001777118 5:174337299-174337321 CCCAAGTAGATTTGCGCCAAGTG No data
Right 1001777126 5:174337331-174337353 ATGTGGCAGAGAGAACTTGGGGG No data
1001777118_1001777128 30 Left 1001777118 5:174337299-174337321 CCCAAGTAGATTTGCGCCAAGTG No data
Right 1001777128 5:174337352-174337374 GGCTCCACTGTGTGTGGCCCTGG No data
1001777118_1001777127 24 Left 1001777118 5:174337299-174337321 CCCAAGTAGATTTGCGCCAAGTG No data
Right 1001777127 5:174337346-174337368 CTTGGGGGCTCCACTGTGTGTGG No data
1001777118_1001777121 -8 Left 1001777118 5:174337299-174337321 CCCAAGTAGATTTGCGCCAAGTG No data
Right 1001777121 5:174337314-174337336 GCCAAGTGTAAAGGAAGATGTGG No data
1001777118_1001777123 6 Left 1001777118 5:174337299-174337321 CCCAAGTAGATTTGCGCCAAGTG No data
Right 1001777123 5:174337328-174337350 AAGATGTGGCAGAGAGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001777118 Original CRISPR CACTTGGCGCAAATCTACTT GGG (reversed) Intergenic
No off target data available for this crispr