ID: 1001777122

View in Genome Browser
Species Human (GRCh38)
Location 5:174337315-174337337
Sequence GCCACATCTTCCTTTACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001777122_1001777124 -9 Left 1001777122 5:174337315-174337337 CCAAGTGTAAAGGAAGATGTGGC No data
Right 1001777124 5:174337329-174337351 AGATGTGGCAGAGAGAACTTGGG No data
1001777122_1001777134 28 Left 1001777122 5:174337315-174337337 CCAAGTGTAAAGGAAGATGTGGC No data
Right 1001777134 5:174337366-174337388 TGGCCCTGGGCCATGCTAGGGGG No data
1001777122_1001777133 27 Left 1001777122 5:174337315-174337337 CCAAGTGTAAAGGAAGATGTGGC No data
Right 1001777133 5:174337365-174337387 GTGGCCCTGGGCCATGCTAGGGG No data
1001777122_1001777128 14 Left 1001777122 5:174337315-174337337 CCAAGTGTAAAGGAAGATGTGGC No data
Right 1001777128 5:174337352-174337374 GGCTCCACTGTGTGTGGCCCTGG No data
1001777122_1001777126 -7 Left 1001777122 5:174337315-174337337 CCAAGTGTAAAGGAAGATGTGGC No data
Right 1001777126 5:174337331-174337353 ATGTGGCAGAGAGAACTTGGGGG No data
1001777122_1001777125 -8 Left 1001777122 5:174337315-174337337 CCAAGTGTAAAGGAAGATGTGGC No data
Right 1001777125 5:174337330-174337352 GATGTGGCAGAGAGAACTTGGGG No data
1001777122_1001777127 8 Left 1001777122 5:174337315-174337337 CCAAGTGTAAAGGAAGATGTGGC No data
Right 1001777127 5:174337346-174337368 CTTGGGGGCTCCACTGTGTGTGG No data
1001777122_1001777123 -10 Left 1001777122 5:174337315-174337337 CCAAGTGTAAAGGAAGATGTGGC No data
Right 1001777123 5:174337328-174337350 AAGATGTGGCAGAGAGAACTTGG No data
1001777122_1001777131 25 Left 1001777122 5:174337315-174337337 CCAAGTGTAAAGGAAGATGTGGC No data
Right 1001777131 5:174337363-174337385 GTGTGGCCCTGGGCCATGCTAGG No data
1001777122_1001777132 26 Left 1001777122 5:174337315-174337337 CCAAGTGTAAAGGAAGATGTGGC No data
Right 1001777132 5:174337364-174337386 TGTGGCCCTGGGCCATGCTAGGG No data
1001777122_1001777129 15 Left 1001777122 5:174337315-174337337 CCAAGTGTAAAGGAAGATGTGGC No data
Right 1001777129 5:174337353-174337375 GCTCCACTGTGTGTGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001777122 Original CRISPR GCCACATCTTCCTTTACACT TGG (reversed) Intergenic
No off target data available for this crispr