ID: 1001777127

View in Genome Browser
Species Human (GRCh38)
Location 5:174337346-174337368
Sequence CTTGGGGGCTCCACTGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001777118_1001777127 24 Left 1001777118 5:174337299-174337321 CCCAAGTAGATTTGCGCCAAGTG No data
Right 1001777127 5:174337346-174337368 CTTGGGGGCTCCACTGTGTGTGG No data
1001777122_1001777127 8 Left 1001777122 5:174337315-174337337 CCAAGTGTAAAGGAAGATGTGGC No data
Right 1001777127 5:174337346-174337368 CTTGGGGGCTCCACTGTGTGTGG No data
1001777119_1001777127 23 Left 1001777119 5:174337300-174337322 CCAAGTAGATTTGCGCCAAGTGT No data
Right 1001777127 5:174337346-174337368 CTTGGGGGCTCCACTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001777127 Original CRISPR CTTGGGGGCTCCACTGTGTG TGG Intergenic
No off target data available for this crispr