ID: 1001777283

View in Genome Browser
Species Human (GRCh38)
Location 5:174338059-174338081
Sequence GAGGCTGATCAAAGGGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001777272_1001777283 28 Left 1001777272 5:174338008-174338030 CCGGCAAGCTGTAGTTAAGAGGT No data
Right 1001777283 5:174338059-174338081 GAGGCTGATCAAAGGGCTGAAGG No data
1001777270_1001777283 29 Left 1001777270 5:174338007-174338029 CCCGGCAAGCTGTAGTTAAGAGG No data
Right 1001777283 5:174338059-174338081 GAGGCTGATCAAAGGGCTGAAGG No data
1001777280_1001777283 -7 Left 1001777280 5:174338043-174338065 CCGGGTTGTCTGCAGGGAGGCTG No data
Right 1001777283 5:174338059-174338081 GAGGCTGATCAAAGGGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001777283 Original CRISPR GAGGCTGATCAAAGGGCTGA AGG Intergenic
No off target data available for this crispr