ID: 1001782059

View in Genome Browser
Species Human (GRCh38)
Location 5:174377571-174377593
Sequence ATGAATATATAGTTGCACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001782057_1001782059 25 Left 1001782057 5:174377523-174377545 CCTATGTGTCTTTCAGTAATTAT No data
Right 1001782059 5:174377571-174377593 ATGAATATATAGTTGCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001782059 Original CRISPR ATGAATATATAGTTGCACAA TGG Intergenic
No off target data available for this crispr