ID: 1001784465

View in Genome Browser
Species Human (GRCh38)
Location 5:174400280-174400302
Sequence CCTACACTAGGACCTCCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001784465_1001784470 17 Left 1001784465 5:174400280-174400302 CCTATAGGAGGTCCTAGTGTAGG No data
Right 1001784470 5:174400320-174400342 AAAGCAGAATGGTGGTTGCCAGG 0: 36
1: 399
2: 1508
3: 3159
4: 4983
1001784465_1001784472 23 Left 1001784465 5:174400280-174400302 CCTATAGGAGGTCCTAGTGTAGG No data
Right 1001784472 5:174400326-174400348 GAATGGTGGTTGCCAGGGCCTGG 0: 16
1: 269
2: 1189
3: 2444
4: 4390
1001784465_1001784468 6 Left 1001784465 5:174400280-174400302 CCTATAGGAGGTCCTAGTGTAGG No data
Right 1001784468 5:174400309-174400331 CATGTAGACAGAAAGCAGAATGG No data
1001784465_1001784471 18 Left 1001784465 5:174400280-174400302 CCTATAGGAGGTCCTAGTGTAGG No data
Right 1001784471 5:174400321-174400343 AAGCAGAATGGTGGTTGCCAGGG 0: 32
1: 379
2: 1393
3: 2869
4: 4591
1001784465_1001784469 9 Left 1001784465 5:174400280-174400302 CCTATAGGAGGTCCTAGTGTAGG No data
Right 1001784469 5:174400312-174400334 GTAGACAGAAAGCAGAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001784465 Original CRISPR CCTACACTAGGACCTCCTAT AGG (reversed) Intergenic
No off target data available for this crispr