ID: 1001784469

View in Genome Browser
Species Human (GRCh38)
Location 5:174400312-174400334
Sequence GTAGACAGAAAGCAGAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001784467_1001784469 -3 Left 1001784467 5:174400292-174400314 CCTAGTGTAGGCAAGTTCATGTA No data
Right 1001784469 5:174400312-174400334 GTAGACAGAAAGCAGAATGGTGG No data
1001784465_1001784469 9 Left 1001784465 5:174400280-174400302 CCTATAGGAGGTCCTAGTGTAGG No data
Right 1001784469 5:174400312-174400334 GTAGACAGAAAGCAGAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001784469 Original CRISPR GTAGACAGAAAGCAGAATGG TGG Intergenic
No off target data available for this crispr