ID: 1001784470

View in Genome Browser
Species Human (GRCh38)
Location 5:174400320-174400342
Sequence AAAGCAGAATGGTGGTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10085
Summary {0: 36, 1: 399, 2: 1508, 3: 3159, 4: 4983}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001784467_1001784470 5 Left 1001784467 5:174400292-174400314 CCTAGTGTAGGCAAGTTCATGTA No data
Right 1001784470 5:174400320-174400342 AAAGCAGAATGGTGGTTGCCAGG 0: 36
1: 399
2: 1508
3: 3159
4: 4983
1001784465_1001784470 17 Left 1001784465 5:174400280-174400302 CCTATAGGAGGTCCTAGTGTAGG No data
Right 1001784470 5:174400320-174400342 AAAGCAGAATGGTGGTTGCCAGG 0: 36
1: 399
2: 1508
3: 3159
4: 4983

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001784470 Original CRISPR AAAGCAGAATGGTGGTTGCC AGG Intergenic
Too many off-targets to display for this crispr