ID: 1001784471

View in Genome Browser
Species Human (GRCh38)
Location 5:174400321-174400343
Sequence AAGCAGAATGGTGGTTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9264
Summary {0: 32, 1: 379, 2: 1393, 3: 2869, 4: 4591}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001784465_1001784471 18 Left 1001784465 5:174400280-174400302 CCTATAGGAGGTCCTAGTGTAGG No data
Right 1001784471 5:174400321-174400343 AAGCAGAATGGTGGTTGCCAGGG 0: 32
1: 379
2: 1393
3: 2869
4: 4591
1001784467_1001784471 6 Left 1001784467 5:174400292-174400314 CCTAGTGTAGGCAAGTTCATGTA No data
Right 1001784471 5:174400321-174400343 AAGCAGAATGGTGGTTGCCAGGG 0: 32
1: 379
2: 1393
3: 2869
4: 4591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001784471 Original CRISPR AAGCAGAATGGTGGTTGCCA GGG Intergenic
Too many off-targets to display for this crispr