ID: 1001784472

View in Genome Browser
Species Human (GRCh38)
Location 5:174400326-174400348
Sequence GAATGGTGGTTGCCAGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8308
Summary {0: 16, 1: 269, 2: 1189, 3: 2444, 4: 4390}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001784467_1001784472 11 Left 1001784467 5:174400292-174400314 CCTAGTGTAGGCAAGTTCATGTA No data
Right 1001784472 5:174400326-174400348 GAATGGTGGTTGCCAGGGCCTGG 0: 16
1: 269
2: 1189
3: 2444
4: 4390
1001784465_1001784472 23 Left 1001784465 5:174400280-174400302 CCTATAGGAGGTCCTAGTGTAGG No data
Right 1001784472 5:174400326-174400348 GAATGGTGGTTGCCAGGGCCTGG 0: 16
1: 269
2: 1189
3: 2444
4: 4390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001784472 Original CRISPR GAATGGTGGTTGCCAGGGCC TGG Intergenic
Too many off-targets to display for this crispr