ID: 1001784474

View in Genome Browser
Species Human (GRCh38)
Location 5:174400342-174400364
Sequence GGCCTGGAGAGTGAAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001784467_1001784474 27 Left 1001784467 5:174400292-174400314 CCTAGTGTAGGCAAGTTCATGTA No data
Right 1001784474 5:174400342-174400364 GGCCTGGAGAGTGAAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001784474 Original CRISPR GGCCTGGAGAGTGAAGAAAA AGG Intergenic
No off target data available for this crispr