ID: 1001787275

View in Genome Browser
Species Human (GRCh38)
Location 5:174424567-174424589
Sequence GGTCTCACCATGCCAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001787268_1001787275 -1 Left 1001787268 5:174424545-174424567 CCCGGCCTGGCACAGGGTCCTGG No data
Right 1001787275 5:174424567-174424589 GGTCTCACCATGCCAGAGGCTGG No data
1001787259_1001787275 12 Left 1001787259 5:174424532-174424554 CCCCCACCTGCTCCCCGGCCTGG No data
Right 1001787275 5:174424567-174424589 GGTCTCACCATGCCAGAGGCTGG No data
1001787267_1001787275 0 Left 1001787267 5:174424544-174424566 CCCCGGCCTGGCACAGGGTCCTG No data
Right 1001787275 5:174424567-174424589 GGTCTCACCATGCCAGAGGCTGG No data
1001787263_1001787275 9 Left 1001787263 5:174424535-174424557 CCACCTGCTCCCCGGCCTGGCAC No data
Right 1001787275 5:174424567-174424589 GGTCTCACCATGCCAGAGGCTGG No data
1001787272_1001787275 -6 Left 1001787272 5:174424550-174424572 CCTGGCACAGGGTCCTGGGTCTC No data
Right 1001787275 5:174424567-174424589 GGTCTCACCATGCCAGAGGCTGG No data
1001787261_1001787275 11 Left 1001787261 5:174424533-174424555 CCCCACCTGCTCCCCGGCCTGGC No data
Right 1001787275 5:174424567-174424589 GGTCTCACCATGCCAGAGGCTGG No data
1001787270_1001787275 -2 Left 1001787270 5:174424546-174424568 CCGGCCTGGCACAGGGTCCTGGG No data
Right 1001787275 5:174424567-174424589 GGTCTCACCATGCCAGAGGCTGG No data
1001787264_1001787275 6 Left 1001787264 5:174424538-174424560 CCTGCTCCCCGGCCTGGCACAGG No data
Right 1001787275 5:174424567-174424589 GGTCTCACCATGCCAGAGGCTGG No data
1001787262_1001787275 10 Left 1001787262 5:174424534-174424556 CCCACCTGCTCCCCGGCCTGGCA No data
Right 1001787275 5:174424567-174424589 GGTCTCACCATGCCAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001787275 Original CRISPR GGTCTCACCATGCCAGAGGC TGG Intergenic
No off target data available for this crispr