ID: 1001788395

View in Genome Browser
Species Human (GRCh38)
Location 5:174433531-174433553
Sequence GGAGAGGAATCCTCCACTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001788392_1001788395 -8 Left 1001788392 5:174433516-174433538 CCACACGAGAAGCCCGGAGAGGA No data
Right 1001788395 5:174433531-174433553 GGAGAGGAATCCTCCACTGTCGG No data
1001788388_1001788395 12 Left 1001788388 5:174433496-174433518 CCGAGAGAGGACTGGCCAATCCA No data
Right 1001788395 5:174433531-174433553 GGAGAGGAATCCTCCACTGTCGG No data
1001788390_1001788395 -3 Left 1001788390 5:174433511-174433533 CCAATCCACACGAGAAGCCCGGA No data
Right 1001788395 5:174433531-174433553 GGAGAGGAATCCTCCACTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001788395 Original CRISPR GGAGAGGAATCCTCCACTGT CGG Intergenic
No off target data available for this crispr