ID: 1001788739

View in Genome Browser
Species Human (GRCh38)
Location 5:174436719-174436741
Sequence CTTCCTTGGCTGGGGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001788739_1001788752 6 Left 1001788739 5:174436719-174436741 CCCCCCACCCCCAGCCAAGGAAG No data
Right 1001788752 5:174436748-174436770 AGTGAGCACACTACCCAGCTGGG No data
1001788739_1001788756 27 Left 1001788739 5:174436719-174436741 CCCCCCACCCCCAGCCAAGGAAG No data
Right 1001788756 5:174436769-174436791 GGGAAACTGTGCTTTTTCCACGG 0: 31
1: 46
2: 56
3: 109
4: 438
1001788739_1001788753 7 Left 1001788739 5:174436719-174436741 CCCCCCACCCCCAGCCAAGGAAG No data
Right 1001788753 5:174436749-174436771 GTGAGCACACTACCCAGCTGGGG No data
1001788739_1001788751 5 Left 1001788739 5:174436719-174436741 CCCCCCACCCCCAGCCAAGGAAG No data
Right 1001788751 5:174436747-174436769 GAGTGAGCACACTACCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001788739 Original CRISPR CTTCCTTGGCTGGGGGTGGG GGG (reversed) Intergenic
No off target data available for this crispr