ID: 1001792621

View in Genome Browser
Species Human (GRCh38)
Location 5:174472233-174472255
Sequence GTGTTATTAGTGTGTATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001792621_1001792622 4 Left 1001792621 5:174472233-174472255 CCTGGAATACACACTAATAACAC No data
Right 1001792622 5:174472260-174472282 GTATGAATATAATCCAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001792621 Original CRISPR GTGTTATTAGTGTGTATTCC AGG (reversed) Intergenic
No off target data available for this crispr