ID: 1001794429

View in Genome Browser
Species Human (GRCh38)
Location 5:174490286-174490308
Sequence CCATAAATGCAGAAGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001794424_1001794429 4 Left 1001794424 5:174490259-174490281 CCTTCTATTGGAATCAGCTTGGG No data
Right 1001794429 5:174490286-174490308 CCATAAATGCAGAAGGCAGCTGG No data
1001794421_1001794429 6 Left 1001794421 5:174490257-174490279 CCCCTTCTATTGGAATCAGCTTG No data
Right 1001794429 5:174490286-174490308 CCATAAATGCAGAAGGCAGCTGG No data
1001794419_1001794429 20 Left 1001794419 5:174490243-174490265 CCAGTGTGGGGAGTCCCCTTCTA No data
Right 1001794429 5:174490286-174490308 CCATAAATGCAGAAGGCAGCTGG No data
1001794422_1001794429 5 Left 1001794422 5:174490258-174490280 CCCTTCTATTGGAATCAGCTTGG No data
Right 1001794429 5:174490286-174490308 CCATAAATGCAGAAGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001794429 Original CRISPR CCATAAATGCAGAAGGCAGC TGG Intergenic
No off target data available for this crispr