ID: 1001794515

View in Genome Browser
Species Human (GRCh38)
Location 5:174490949-174490971
Sequence CCTCATTCCCACCTGTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001794515_1001794519 2 Left 1001794515 5:174490949-174490971 CCAGGCAACAGGTGGGAATGAGG No data
Right 1001794519 5:174490974-174490996 GTAGATGTAACCACGGGAACAGG No data
1001794515_1001794522 13 Left 1001794515 5:174490949-174490971 CCAGGCAACAGGTGGGAATGAGG No data
Right 1001794522 5:174490985-174491007 CACGGGAACAGGAAGAGAATGGG No data
1001794515_1001794518 -4 Left 1001794515 5:174490949-174490971 CCAGGCAACAGGTGGGAATGAGG No data
Right 1001794518 5:174490968-174490990 GAGGAAGTAGATGTAACCACGGG No data
1001794515_1001794521 12 Left 1001794515 5:174490949-174490971 CCAGGCAACAGGTGGGAATGAGG No data
Right 1001794521 5:174490984-174491006 CCACGGGAACAGGAAGAGAATGG No data
1001794515_1001794517 -5 Left 1001794515 5:174490949-174490971 CCAGGCAACAGGTGGGAATGAGG No data
Right 1001794517 5:174490967-174490989 TGAGGAAGTAGATGTAACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001794515 Original CRISPR CCTCATTCCCACCTGTTGCC TGG (reversed) Intergenic
No off target data available for this crispr