ID: 1001795878

View in Genome Browser
Species Human (GRCh38)
Location 5:174502064-174502086
Sequence TCCCATAAGCAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001795873_1001795878 12 Left 1001795873 5:174502029-174502051 CCAGGGACGCGGGATCTGGCACA No data
Right 1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG No data
1001795870_1001795878 22 Left 1001795870 5:174502019-174502041 CCTAAAAAAGCCAGGGACGCGGG No data
Right 1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG No data
1001795868_1001795878 26 Left 1001795868 5:174502015-174502037 CCTTCCTAAAAAAGCCAGGGACG No data
Right 1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001795878 Original CRISPR TCCCATAAGCAGAAGGTGGA GGG Intergenic
No off target data available for this crispr