ID: 1001796180

View in Genome Browser
Species Human (GRCh38)
Location 5:174504218-174504240
Sequence CTTTCTTTGCAGGAAATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001796177_1001796180 3 Left 1001796177 5:174504192-174504214 CCAGCATGGATTAGCTTGCAACA No data
Right 1001796180 5:174504218-174504240 CTTTCTTTGCAGGAAATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001796180 Original CRISPR CTTTCTTTGCAGGAAATGAA GGG Intergenic
No off target data available for this crispr