ID: 1001796700

View in Genome Browser
Species Human (GRCh38)
Location 5:174508230-174508252
Sequence GCAAAGGTATGCTGTGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001796693_1001796700 16 Left 1001796693 5:174508191-174508213 CCAGGTGGAGGAGCATCCCAGAT No data
Right 1001796700 5:174508230-174508252 GCAAAGGTATGCTGTGAAAGGGG No data
1001796695_1001796700 0 Left 1001796695 5:174508207-174508229 CCCAGATAAAAGGTAGAGCACAA No data
Right 1001796700 5:174508230-174508252 GCAAAGGTATGCTGTGAAAGGGG No data
1001796696_1001796700 -1 Left 1001796696 5:174508208-174508230 CCAGATAAAAGGTAGAGCACAAG No data
Right 1001796700 5:174508230-174508252 GCAAAGGTATGCTGTGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001796700 Original CRISPR GCAAAGGTATGCTGTGAAAG GGG Intergenic
No off target data available for this crispr