ID: 1001804473

View in Genome Browser
Species Human (GRCh38)
Location 5:174571456-174571478
Sequence CCAACTCAAAATGGTTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001804473_1001804480 13 Left 1001804473 5:174571456-174571478 CCTTTTAAACCATTTTGAGTTGG No data
Right 1001804480 5:174571492-174571514 AGGTACTTAATCAATGCAGGCGG No data
1001804473_1001804478 -7 Left 1001804473 5:174571456-174571478 CCTTTTAAACCATTTTGAGTTGG No data
Right 1001804478 5:174571472-174571494 GAGTTGGTCTTTGGACATGGAGG No data
1001804473_1001804479 10 Left 1001804473 5:174571456-174571478 CCTTTTAAACCATTTTGAGTTGG No data
Right 1001804479 5:174571489-174571511 TGGAGGTACTTAATCAATGCAGG No data
1001804473_1001804477 -10 Left 1001804473 5:174571456-174571478 CCTTTTAAACCATTTTGAGTTGG No data
Right 1001804477 5:174571469-174571491 TTTGAGTTGGTCTTTGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001804473 Original CRISPR CCAACTCAAAATGGTTTAAA AGG (reversed) Intergenic
No off target data available for this crispr