ID: 1001804733

View in Genome Browser
Species Human (GRCh38)
Location 5:174573650-174573672
Sequence GACCCACGGAGGCTGCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001804729_1001804733 5 Left 1001804729 5:174573622-174573644 CCAGAGGGCGGAACTGGGGCACG No data
Right 1001804733 5:174573650-174573672 GACCCACGGAGGCTGCTTGTGGG No data
1001804726_1001804733 10 Left 1001804726 5:174573617-174573639 CCACTCCAGAGGGCGGAACTGGG No data
Right 1001804733 5:174573650-174573672 GACCCACGGAGGCTGCTTGTGGG No data
1001804724_1001804733 11 Left 1001804724 5:174573616-174573638 CCCACTCCAGAGGGCGGAACTGG No data
Right 1001804733 5:174573650-174573672 GACCCACGGAGGCTGCTTGTGGG No data
1001804720_1001804733 25 Left 1001804720 5:174573602-174573624 CCAGCGGAGCTGCTCCCACTCCA No data
Right 1001804733 5:174573650-174573672 GACCCACGGAGGCTGCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001804733 Original CRISPR GACCCACGGAGGCTGCTTGT GGG Intergenic
No off target data available for this crispr