ID: 1001805447

View in Genome Browser
Species Human (GRCh38)
Location 5:174581703-174581725
Sequence TCTCCCGGGATCCCCTCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001805447_1001805452 4 Left 1001805447 5:174581703-174581725 CCGCCAGAGGGGATCCCGGGAGA No data
Right 1001805452 5:174581730-174581752 AGTAGTTGTGACTGACTTCCTGG No data
1001805447_1001805454 28 Left 1001805447 5:174581703-174581725 CCGCCAGAGGGGATCCCGGGAGA No data
Right 1001805454 5:174581754-174581776 ATCTGCACTTGTTTCTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001805447 Original CRISPR TCTCCCGGGATCCCCTCTGG CGG (reversed) Intergenic
No off target data available for this crispr