ID: 1001805452

View in Genome Browser
Species Human (GRCh38)
Location 5:174581730-174581752
Sequence AGTAGTTGTGACTGACTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001805447_1001805452 4 Left 1001805447 5:174581703-174581725 CCGCCAGAGGGGATCCCGGGAGA No data
Right 1001805452 5:174581730-174581752 AGTAGTTGTGACTGACTTCCTGG No data
1001805450_1001805452 -10 Left 1001805450 5:174581717-174581739 CCCGGGAGAGGAAAGTAGTTGTG No data
Right 1001805452 5:174581730-174581752 AGTAGTTGTGACTGACTTCCTGG No data
1001805449_1001805452 1 Left 1001805449 5:174581706-174581728 CCAGAGGGGATCCCGGGAGAGGA No data
Right 1001805452 5:174581730-174581752 AGTAGTTGTGACTGACTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001805452 Original CRISPR AGTAGTTGTGACTGACTTCC TGG Intergenic