ID: 1001805454

View in Genome Browser
Species Human (GRCh38)
Location 5:174581754-174581776
Sequence ATCTGCACTTGTTTCTAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001805450_1001805454 14 Left 1001805450 5:174581717-174581739 CCCGGGAGAGGAAAGTAGTTGTG No data
Right 1001805454 5:174581754-174581776 ATCTGCACTTGTTTCTAGTTTGG No data
1001805449_1001805454 25 Left 1001805449 5:174581706-174581728 CCAGAGGGGATCCCGGGAGAGGA No data
Right 1001805454 5:174581754-174581776 ATCTGCACTTGTTTCTAGTTTGG No data
1001805451_1001805454 13 Left 1001805451 5:174581718-174581740 CCGGGAGAGGAAAGTAGTTGTGA No data
Right 1001805454 5:174581754-174581776 ATCTGCACTTGTTTCTAGTTTGG No data
1001805447_1001805454 28 Left 1001805447 5:174581703-174581725 CCGCCAGAGGGGATCCCGGGAGA No data
Right 1001805454 5:174581754-174581776 ATCTGCACTTGTTTCTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001805454 Original CRISPR ATCTGCACTTGTTTCTAGTT TGG Intergenic