ID: 1001815782

View in Genome Browser
Species Human (GRCh38)
Location 5:174668336-174668358
Sequence GGTTGCAAACAGGTGGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001815782_1001815788 24 Left 1001815782 5:174668336-174668358 CCTCAGGCCACCTGTTTGCAACC No data
Right 1001815788 5:174668383-174668405 TAGTTCAGGCTTGATTCCACTGG No data
1001815782_1001815787 10 Left 1001815782 5:174668336-174668358 CCTCAGGCCACCTGTTTGCAACC No data
Right 1001815787 5:174668369-174668391 TTGTAACGGACTAATAGTTCAGG No data
1001815782_1001815785 -4 Left 1001815782 5:174668336-174668358 CCTCAGGCCACCTGTTTGCAACC No data
Right 1001815785 5:174668355-174668377 AACCTCTATATTCATTGTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001815782 Original CRISPR GGTTGCAAACAGGTGGCCTG AGG (reversed) Intergenic
No off target data available for this crispr