ID: 1001822022

View in Genome Browser
Species Human (GRCh38)
Location 5:174718074-174718096
Sequence CCAGTGCCCAGAAGAGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001822022_1001822025 10 Left 1001822022 5:174718074-174718096 CCAAAGGCTCTTCTGGGCACTGG No data
Right 1001822025 5:174718107-174718129 GTGAATGCATGACAAATCCTGGG No data
1001822022_1001822027 12 Left 1001822022 5:174718074-174718096 CCAAAGGCTCTTCTGGGCACTGG No data
Right 1001822027 5:174718109-174718131 GAATGCATGACAAATCCTGGGGG No data
1001822022_1001822028 24 Left 1001822022 5:174718074-174718096 CCAAAGGCTCTTCTGGGCACTGG No data
Right 1001822028 5:174718121-174718143 AATCCTGGGGGCCCCCACATCGG No data
1001822022_1001822024 9 Left 1001822022 5:174718074-174718096 CCAAAGGCTCTTCTGGGCACTGG No data
Right 1001822024 5:174718106-174718128 TGTGAATGCATGACAAATCCTGG No data
1001822022_1001822029 25 Left 1001822022 5:174718074-174718096 CCAAAGGCTCTTCTGGGCACTGG No data
Right 1001822029 5:174718122-174718144 ATCCTGGGGGCCCCCACATCGGG No data
1001822022_1001822026 11 Left 1001822022 5:174718074-174718096 CCAAAGGCTCTTCTGGGCACTGG No data
Right 1001822026 5:174718108-174718130 TGAATGCATGACAAATCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001822022 Original CRISPR CCAGTGCCCAGAAGAGCCTT TGG (reversed) Intergenic
No off target data available for this crispr