ID: 1001826807

View in Genome Browser
Species Human (GRCh38)
Location 5:174751739-174751761
Sequence AGGGCGGCGCGACCGGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001826792_1001826807 23 Left 1001826792 5:174751693-174751715 CCCGCCATCAGCTGCGCGCACAG No data
Right 1001826807 5:174751739-174751761 AGGGCGGCGCGACCGGCCCGGGG No data
1001826793_1001826807 22 Left 1001826793 5:174751694-174751716 CCGCCATCAGCTGCGCGCACAGA No data
Right 1001826807 5:174751739-174751761 AGGGCGGCGCGACCGGCCCGGGG No data
1001826795_1001826807 19 Left 1001826795 5:174751697-174751719 CCATCAGCTGCGCGCACAGAGGG No data
Right 1001826807 5:174751739-174751761 AGGGCGGCGCGACCGGCCCGGGG No data
1001826791_1001826807 24 Left 1001826791 5:174751692-174751714 CCCCGCCATCAGCTGCGCGCACA No data
Right 1001826807 5:174751739-174751761 AGGGCGGCGCGACCGGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001826807 Original CRISPR AGGGCGGCGCGACCGGCCCG GGG Intergenic
No off target data available for this crispr