ID: 1001829521

View in Genome Browser
Species Human (GRCh38)
Location 5:174773914-174773936
Sequence CAAGCCCATTCCCAAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001829521_1001829532 23 Left 1001829521 5:174773914-174773936 CCTCTCTCTTGGGAATGGGCTTG No data
Right 1001829532 5:174773960-174773982 GTGGCCCTAAGGGCTTCTCCAGG No data
1001829521_1001829529 13 Left 1001829521 5:174773914-174773936 CCTCTCTCTTGGGAATGGGCTTG No data
Right 1001829529 5:174773950-174773972 GGGCTTCCCAGTGGCCCTAAGGG No data
1001829521_1001829526 -7 Left 1001829521 5:174773914-174773936 CCTCTCTCTTGGGAATGGGCTTG No data
Right 1001829526 5:174773930-174773952 GGGCTTGAAAGCTCGGATGGGGG No data
1001829521_1001829533 24 Left 1001829521 5:174773914-174773936 CCTCTCTCTTGGGAATGGGCTTG No data
Right 1001829533 5:174773961-174773983 TGGCCCTAAGGGCTTCTCCAGGG No data
1001829521_1001829528 12 Left 1001829521 5:174773914-174773936 CCTCTCTCTTGGGAATGGGCTTG No data
Right 1001829528 5:174773949-174773971 GGGGCTTCCCAGTGGCCCTAAGG No data
1001829521_1001829523 -10 Left 1001829521 5:174773914-174773936 CCTCTCTCTTGGGAATGGGCTTG No data
Right 1001829523 5:174773927-174773949 AATGGGCTTGAAAGCTCGGATGG No data
1001829521_1001829524 -9 Left 1001829521 5:174773914-174773936 CCTCTCTCTTGGGAATGGGCTTG No data
Right 1001829524 5:174773928-174773950 ATGGGCTTGAAAGCTCGGATGGG No data
1001829521_1001829525 -8 Left 1001829521 5:174773914-174773936 CCTCTCTCTTGGGAATGGGCTTG No data
Right 1001829525 5:174773929-174773951 TGGGCTTGAAAGCTCGGATGGGG No data
1001829521_1001829527 4 Left 1001829521 5:174773914-174773936 CCTCTCTCTTGGGAATGGGCTTG No data
Right 1001829527 5:174773941-174773963 CTCGGATGGGGGCTTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001829521 Original CRISPR CAAGCCCATTCCCAAGAGAG AGG (reversed) Intergenic
No off target data available for this crispr