ID: 1001832970

View in Genome Browser
Species Human (GRCh38)
Location 5:174805080-174805102
Sequence GTGAAGACACAGATGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001832970_1001832977 25 Left 1001832970 5:174805080-174805102 CCCTCCTGCATCTGTGTCTTCAC No data
Right 1001832977 5:174805128-174805150 ACATCAATCATATTGGATTAGGG No data
1001832970_1001832975 18 Left 1001832970 5:174805080-174805102 CCCTCCTGCATCTGTGTCTTCAC No data
Right 1001832975 5:174805121-174805143 TATAAAGACATCAATCATATTGG No data
1001832970_1001832976 24 Left 1001832970 5:174805080-174805102 CCCTCCTGCATCTGTGTCTTCAC No data
Right 1001832976 5:174805127-174805149 GACATCAATCATATTGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001832970 Original CRISPR GTGAAGACACAGATGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr