ID: 1001834951

View in Genome Browser
Species Human (GRCh38)
Location 5:174824100-174824122
Sequence CAGGCTCTGAGGGGCTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001834951_1001834963 25 Left 1001834951 5:174824100-174824122 CCTCAGGAGCCCCTCAGAGCCTG No data
Right 1001834963 5:174824148-174824170 CTCTCCCTCTCCTGAAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001834951 Original CRISPR CAGGCTCTGAGGGGCTCCTG AGG (reversed) Intergenic
No off target data available for this crispr