ID: 1001838465

View in Genome Browser
Species Human (GRCh38)
Location 5:174852815-174852837
Sequence ACAAAGAGAGGAAACTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001838458_1001838465 8 Left 1001838458 5:174852784-174852806 CCTTGAAATGAAGAAGAGTATTT No data
Right 1001838465 5:174852815-174852837 ACAAAGAGAGGAAACTGGGAGGG No data
1001838457_1001838465 9 Left 1001838457 5:174852783-174852805 CCCTTGAAATGAAGAAGAGTATT No data
Right 1001838465 5:174852815-174852837 ACAAAGAGAGGAAACTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001838465 Original CRISPR ACAAAGAGAGGAAACTGGGA GGG Intergenic
No off target data available for this crispr