ID: 1001838821

View in Genome Browser
Species Human (GRCh38)
Location 5:174855707-174855729
Sequence AGTTATTCACAGAAGATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001838821_1001838824 4 Left 1001838821 5:174855707-174855729 CCTGCTATCTTCTGTGAATAACT No data
Right 1001838824 5:174855734-174855756 TCCTTTTGGGAAGCAGCTTTTGG No data
1001838821_1001838822 -10 Left 1001838821 5:174855707-174855729 CCTGCTATCTTCTGTGAATAACT No data
Right 1001838822 5:174855720-174855742 GTGAATAACTATTCTCCTTTTGG No data
1001838821_1001838823 -9 Left 1001838821 5:174855707-174855729 CCTGCTATCTTCTGTGAATAACT No data
Right 1001838823 5:174855721-174855743 TGAATAACTATTCTCCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001838821 Original CRISPR AGTTATTCACAGAAGATAGC AGG (reversed) Intergenic
No off target data available for this crispr