ID: 1001839727

View in Genome Browser
Species Human (GRCh38)
Location 5:174864869-174864891
Sequence CTCCCTGGGTGGGGACAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001839727_1001839735 13 Left 1001839727 5:174864869-174864891 CCACCCTGTCCCCACCCAGGGAG No data
Right 1001839735 5:174864905-174864927 TCAGTTGCGAGTCCCAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001839727 Original CRISPR CTCCCTGGGTGGGGACAGGG TGG (reversed) Intergenic
No off target data available for this crispr