ID: 1001842997

View in Genome Browser
Species Human (GRCh38)
Location 5:174895410-174895432
Sequence AATTAATGCCTGATGATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2984
Summary {0: 23, 1: 357, 2: 1055, 3: 915, 4: 634}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001842997_1001842998 -9 Left 1001842997 5:174895410-174895432 CCTCAGATCATCAGGCATTAATT 0: 23
1: 357
2: 1055
3: 915
4: 634
Right 1001842998 5:174895424-174895446 GCATTAATTAGATTCTAAGAAGG No data
1001842997_1001842999 -3 Left 1001842997 5:174895410-174895432 CCTCAGATCATCAGGCATTAATT 0: 23
1: 357
2: 1055
3: 915
4: 634
Right 1001842999 5:174895430-174895452 ATTAGATTCTAAGAAGGTGCAGG No data
1001842997_1001843000 19 Left 1001842997 5:174895410-174895432 CCTCAGATCATCAGGCATTAATT 0: 23
1: 357
2: 1055
3: 915
4: 634
Right 1001843000 5:174895452-174895474 GCATTAATTAGATTCTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001842997 Original CRISPR AATTAATGCCTGATGATCTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr