ID: 1001842999

View in Genome Browser
Species Human (GRCh38)
Location 5:174895430-174895452
Sequence ATTAGATTCTAAGAAGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001842997_1001842999 -3 Left 1001842997 5:174895410-174895432 CCTCAGATCATCAGGCATTAATT 0: 23
1: 357
2: 1055
3: 915
4: 634
Right 1001842999 5:174895430-174895452 ATTAGATTCTAAGAAGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001842999 Original CRISPR ATTAGATTCTAAGAAGGTGC AGG Intergenic
No off target data available for this crispr