ID: 1001843845

View in Genome Browser
Species Human (GRCh38)
Location 5:174903717-174903739
Sequence GTCCCCTCCATTAGTGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001843845_1001843847 -3 Left 1001843845 5:174903717-174903739 CCAAGGACACTAATGGAGGGGAC No data
Right 1001843847 5:174903737-174903759 GACCAGTAGTAAAGATTTGGTGG No data
1001843845_1001843846 -6 Left 1001843845 5:174903717-174903739 CCAAGGACACTAATGGAGGGGAC No data
Right 1001843846 5:174903734-174903756 GGGGACCAGTAGTAAAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001843845 Original CRISPR GTCCCCTCCATTAGTGTCCT TGG (reversed) Intergenic
No off target data available for this crispr